Incidental Mutation 'R3731:Slc16a10'
ID270991
Institutional Source Beutler Lab
Gene Symbol Slc16a10
Ensembl Gene ENSMUSG00000019838
Gene Namesolute carrier family 16 (monocarboxylic acid transporters), member 10
SynonymsMct10, 2610103N14Rik, TAT1, PRO0813
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.095) question?
Stock #R3731 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location40033532-40142258 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to C at 40056624 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Aspartic acid at position 314 (H314D)
Ref Sequence ENSEMBL: ENSMUSP00000090227 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092566]
Predicted Effect possibly damaging
Transcript: ENSMUST00000092566
AA Change: H314D

PolyPhen 2 Score 0.942 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000090227
Gene: ENSMUSG00000019838
AA Change: H314D

DomainStartEndE-ValueType
Pfam:MFS_1 66 320 1.1e-13 PFAM
Pfam:MFS_4 269 464 4.3e-11 PFAM
Pfam:MFS_1 291 507 4.3e-18 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000213827
AA Change: H27D
Meta Mutation Damage Score 0.6759 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] SLC16A10 is a member of a family of plasma membrane amino acid transporters that mediate the Na(+)-independent transport of aromatic amino acids across the plasma membrane.[supplied by OMIM, Apr 2004]
PHENOTYPE: Mice homozygous for an ENU-induced null allele exhibit altered amino acid homeostasis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A630010A05Rik T A 16: 14,609,621 probably null Het
Abcc5 A T 16: 20,398,934 Y5* probably null Het
Acbd6 T A 1: 155,558,725 S30T probably benign Het
Adar T C 3: 89,746,655 I325T probably damaging Het
Akap13 T C 7: 75,611,377 S92P probably benign Het
Atp1a4 A T 1: 172,233,961 V771E probably damaging Het
BC030867 A G 11: 102,257,906 E381G possibly damaging Het
Cfh A G 1: 140,119,970 S492P possibly damaging Het
Crlf1 A G 8: 70,499,442 T95A probably benign Het
Dennd2d T G 3: 106,499,955 F441V probably damaging Het
Dhx33 T C 11: 70,989,152 D344G probably benign Het
Disp3 A G 4: 148,252,827 S844P probably benign Het
Dock2 T C 11: 34,708,895 K286E probably damaging Het
Fam228a T C 12: 4,718,671 E203G probably benign Het
Fbxo38 GTGCTGCTGCTGCTGCTGCTGC GTGCTGCTGCTGCTGCTGC 18: 62,515,328 probably benign Het
Frmpd4 G A X: 167,486,807 T493M probably damaging Het
Galnt13 A G 2: 54,933,507 N365S possibly damaging Het
Ighv1-19 C A 12: 114,708,877 C40F probably damaging Het
Ints4 A G 7: 97,506,101 Q320R probably benign Het
Kctd5 T C 17: 24,059,238 D146G probably benign Het
Loxl3 T C 6: 83,050,671 probably null Het
Lrp2 G A 2: 69,464,579 P3465L probably damaging Het
Lrp2 A T 2: 69,534,907 probably null Het
Manba G A 3: 135,554,850 V599I probably benign Het
Mbd6 A G 10: 127,285,768 probably benign Het
Mrc2 G A 11: 105,348,431 probably null Het
Nepn A T 10: 52,404,014 N401Y probably damaging Het
Nol10 A T 12: 17,424,673 K622I probably benign Het
Npas3 T C 12: 53,354,392 I40T probably benign Het
Olfr348 A T 2: 36,786,566 I14F possibly damaging Het
Olfr389 T C 11: 73,776,739 E196G probably benign Het
Olfr498 T C 7: 108,465,426 I34T possibly damaging Het
Olfr710 T A 7: 106,944,477 N175Y probably damaging Het
Olfr733 T A 14: 50,298,505 D268V probably damaging Het
Olfr952 T A 9: 39,427,069 M1L probably benign Het
Phtf1 A G 3: 103,985,779 M120V probably benign Het
Plxna2 A G 1: 194,788,885 Y988C probably benign Het
Rgs12 G A 5: 35,032,251 E658K probably damaging Het
Ripor3 C G 2: 167,992,819 E251Q probably damaging Het
Sec24b T C 3: 130,033,833 K203R possibly damaging Het
Serpina1d T A 12: 103,767,905 N47Y possibly damaging Het
Setx GTGGCT GT 2: 29,154,061 probably null Het
Sirpb1c T C 3: 15,833,123 K184R probably damaging Het
Upp2 T C 2: 58,755,367 S41P probably benign Het
Vmn1r10 A G 6: 57,113,734 T104A probably damaging Het
Wdhd1 A C 14: 47,247,892 S838R possibly damaging Het
Zer1 A G 2: 30,110,911 V166A probably benign Het
Zfp217 T C 2: 170,114,388 N897D probably benign Het
Zfp960 T A 17: 17,088,371 L449H probably damaging Het
Other mutations in Slc16a10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01140:Slc16a10 APN 10 40076925 missense probably damaging 1.00
R0030:Slc16a10 UTSW 10 40076823 missense probably benign 0.04
R0196:Slc16a10 UTSW 10 40056615 missense probably benign 0.01
R0200:Slc16a10 UTSW 10 40040616 missense probably benign 0.37
R0418:Slc16a10 UTSW 10 40040631 nonsense probably null
R0463:Slc16a10 UTSW 10 40040616 missense probably benign 0.37
R0599:Slc16a10 UTSW 10 40141918 missense probably benign
R1162:Slc16a10 UTSW 10 40076553 missense probably benign 0.00
R1554:Slc16a10 UTSW 10 40076800 missense probably benign 0.00
R1901:Slc16a10 UTSW 10 40056606 nonsense probably null
R3622:Slc16a10 UTSW 10 40141894 missense probably benign
R3624:Slc16a10 UTSW 10 40141894 missense probably benign
R3717:Slc16a10 UTSW 10 40056624 missense possibly damaging 0.94
R3719:Slc16a10 UTSW 10 40056624 missense possibly damaging 0.94
R3729:Slc16a10 UTSW 10 40056624 missense possibly damaging 0.94
R3730:Slc16a10 UTSW 10 40056624 missense possibly damaging 0.94
R3801:Slc16a10 UTSW 10 40056624 missense possibly damaging 0.94
R3803:Slc16a10 UTSW 10 40056624 missense possibly damaging 0.94
R3804:Slc16a10 UTSW 10 40056624 missense possibly damaging 0.94
R4037:Slc16a10 UTSW 10 40056624 missense possibly damaging 0.94
R4038:Slc16a10 UTSW 10 40056624 missense possibly damaging 0.94
R4254:Slc16a10 UTSW 10 40077001 missense probably damaging 1.00
R4980:Slc16a10 UTSW 10 40080805 missense probably damaging 1.00
R5498:Slc16a10 UTSW 10 40037327 missense probably damaging 0.99
R5542:Slc16a10 UTSW 10 40076788 missense probably benign 0.03
R6541:Slc16a10 UTSW 10 40037272 missense probably benign 0.00
R6555:Slc16a10 UTSW 10 40080778 missense probably benign 0.41
R6998:Slc16a10 UTSW 10 40056503 missense possibly damaging 0.63
R7171:Slc16a10 UTSW 10 40037259 missense probably benign 0.03
R7354:Slc16a10 UTSW 10 40076955 missense probably damaging 1.00
R7414:Slc16a10 UTSW 10 40141996 missense probably benign 0.02
R7728:Slc16a10 UTSW 10 40040758 missense probably damaging 1.00
R7792:Slc16a10 UTSW 10 40037415 splice site probably null
Z1177:Slc16a10 UTSW 10 40076971 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTCTGCTACAGAAGGAGCACC -3'
(R):5'- ACGGACTTATCACAGGAGCTG -3'

Sequencing Primer
(F):5'- ACCCAGAGAGGACCTTCAGG -3'
(R):5'- TCACAGGAGCTGCTTTTAAATG -3'
Posted On2015-03-18