Incidental Mutation 'R3731:Mbd6'
ID270993
Institutional Source Beutler Lab
Gene Symbol Mbd6
Ensembl Gene ENSMUSG00000025409
Gene Namemethyl-CpG binding domain protein 6
SynonymsD10Wsu93e
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3731 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location127281956-127289018 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) A to G at 127285768 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000134527 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026476] [ENSMUST00000026479] [ENSMUST00000119078] [ENSMUST00000156208] [ENSMUST00000172567]
Predicted Effect unknown
Transcript: ENSMUST00000026476
AA Change: V397A
SMART Domains Protein: ENSMUSP00000026476
Gene: ENSMUSG00000025409
AA Change: V397A

DomainStartEndE-ValueType
Blast:MBD 26 79 8e-10 BLAST
low complexity region 80 94 N/A INTRINSIC
low complexity region 140 155 N/A INTRINSIC
low complexity region 183 197 N/A INTRINSIC
low complexity region 212 229 N/A INTRINSIC
low complexity region 247 262 N/A INTRINSIC
low complexity region 269 295 N/A INTRINSIC
low complexity region 311 342 N/A INTRINSIC
low complexity region 347 378 N/A INTRINSIC
low complexity region 383 428 N/A INTRINSIC
low complexity region 442 455 N/A INTRINSIC
low complexity region 461 498 N/A INTRINSIC
low complexity region 500 517 N/A INTRINSIC
low complexity region 533 563 N/A INTRINSIC
low complexity region 566 634 N/A INTRINSIC
low complexity region 636 652 N/A INTRINSIC
low complexity region 653 674 N/A INTRINSIC
low complexity region 676 686 N/A INTRINSIC
low complexity region 733 799 N/A INTRINSIC
low complexity region 815 849 N/A INTRINSIC
low complexity region 853 890 N/A INTRINSIC
low complexity region 949 958 N/A INTRINSIC
low complexity region 978 1002 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000026479
SMART Domains Protein: ENSMUSP00000026479
Gene: ENSMUSG00000025410

DomainStartEndE-ValueType
Pfam:Dynamitin 16 400 7.1e-129 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000119078
AA Change: V397A
SMART Domains Protein: ENSMUSP00000112805
Gene: ENSMUSG00000025409
AA Change: V397A

DomainStartEndE-ValueType
Blast:MBD 26 79 8e-10 BLAST
low complexity region 80 94 N/A INTRINSIC
low complexity region 140 155 N/A INTRINSIC
low complexity region 183 197 N/A INTRINSIC
low complexity region 212 229 N/A INTRINSIC
low complexity region 247 262 N/A INTRINSIC
low complexity region 269 295 N/A INTRINSIC
low complexity region 311 342 N/A INTRINSIC
low complexity region 347 378 N/A INTRINSIC
low complexity region 383 428 N/A INTRINSIC
low complexity region 442 455 N/A INTRINSIC
low complexity region 461 498 N/A INTRINSIC
low complexity region 500 517 N/A INTRINSIC
low complexity region 533 563 N/A INTRINSIC
low complexity region 566 634 N/A INTRINSIC
low complexity region 636 652 N/A INTRINSIC
low complexity region 653 674 N/A INTRINSIC
low complexity region 676 686 N/A INTRINSIC
low complexity region 733 798 N/A INTRINSIC
low complexity region 813 847 N/A INTRINSIC
low complexity region 851 888 N/A INTRINSIC
low complexity region 947 956 N/A INTRINSIC
low complexity region 976 1000 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000126243
AA Change: V44A
SMART Domains Protein: ENSMUSP00000115238
Gene: ENSMUSG00000025409
AA Change: V44A

DomainStartEndE-ValueType
low complexity region 1 26 N/A INTRINSIC
low complexity region 31 76 N/A INTRINSIC
low complexity region 90 103 N/A INTRINSIC
low complexity region 109 146 N/A INTRINSIC
low complexity region 148 165 N/A INTRINSIC
low complexity region 181 211 N/A INTRINSIC
low complexity region 214 282 N/A INTRINSIC
low complexity region 284 300 N/A INTRINSIC
low complexity region 301 322 N/A INTRINSIC
low complexity region 324 334 N/A INTRINSIC
low complexity region 381 446 N/A INTRINSIC
low complexity region 462 496 N/A INTRINSIC
low complexity region 500 537 N/A INTRINSIC
low complexity region 596 610 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000136169
SMART Domains Protein: ENSMUSP00000122504
Gene: ENSMUSG00000025409

DomainStartEndE-ValueType
low complexity region 55 64 N/A INTRINSIC
low complexity region 84 108 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000154851
SMART Domains Protein: ENSMUSP00000133835
Gene: ENSMUSG00000025409

DomainStartEndE-ValueType
low complexity region 2 61 N/A INTRINSIC
low complexity region 72 81 N/A INTRINSIC
low complexity region 101 125 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000156208
SMART Domains Protein: ENSMUSP00000114590
Gene: ENSMUSG00000025409

DomainStartEndE-ValueType
SCOP:d1qk9a_ 22 88 6e-5 SMART
Blast:MBD 26 79 6e-12 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000172567
SMART Domains Protein: ENSMUSP00000134527
Gene: ENSMUSG00000025409

DomainStartEndE-ValueType
low complexity region 1 66 N/A INTRINSIC
low complexity region 81 115 N/A INTRINSIC
low complexity region 119 156 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172591
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174141
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174167
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218556
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218752
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A630010A05Rik T A 16: 14,609,621 probably null Het
Abcc5 A T 16: 20,398,934 Y5* probably null Het
Acbd6 T A 1: 155,558,725 S30T probably benign Het
Adar T C 3: 89,746,655 I325T probably damaging Het
Akap13 T C 7: 75,611,377 S92P probably benign Het
Atp1a4 A T 1: 172,233,961 V771E probably damaging Het
BC030867 A G 11: 102,257,906 E381G possibly damaging Het
Cfh A G 1: 140,119,970 S492P possibly damaging Het
Crlf1 A G 8: 70,499,442 T95A probably benign Het
Dennd2d T G 3: 106,499,955 F441V probably damaging Het
Dhx33 T C 11: 70,989,152 D344G probably benign Het
Disp3 A G 4: 148,252,827 S844P probably benign Het
Dock2 T C 11: 34,708,895 K286E probably damaging Het
Fam228a T C 12: 4,718,671 E203G probably benign Het
Fbxo38 GTGCTGCTGCTGCTGCTGCTGC GTGCTGCTGCTGCTGCTGC 18: 62,515,328 probably benign Het
Frmpd4 G A X: 167,486,807 T493M probably damaging Het
Galnt13 A G 2: 54,933,507 N365S possibly damaging Het
Ighv1-19 C A 12: 114,708,877 C40F probably damaging Het
Ints4 A G 7: 97,506,101 Q320R probably benign Het
Kctd5 T C 17: 24,059,238 D146G probably benign Het
Loxl3 T C 6: 83,050,671 probably null Het
Lrp2 G A 2: 69,464,579 P3465L probably damaging Het
Lrp2 A T 2: 69,534,907 probably null Het
Manba G A 3: 135,554,850 V599I probably benign Het
Mrc2 G A 11: 105,348,431 probably null Het
Nepn A T 10: 52,404,014 N401Y probably damaging Het
Nol10 A T 12: 17,424,673 K622I probably benign Het
Npas3 T C 12: 53,354,392 I40T probably benign Het
Olfr348 A T 2: 36,786,566 I14F possibly damaging Het
Olfr389 T C 11: 73,776,739 E196G probably benign Het
Olfr498 T C 7: 108,465,426 I34T possibly damaging Het
Olfr710 T A 7: 106,944,477 N175Y probably damaging Het
Olfr733 T A 14: 50,298,505 D268V probably damaging Het
Olfr952 T A 9: 39,427,069 M1L probably benign Het
Phtf1 A G 3: 103,985,779 M120V probably benign Het
Plxna2 A G 1: 194,788,885 Y988C probably benign Het
Rgs12 G A 5: 35,032,251 E658K probably damaging Het
Ripor3 C G 2: 167,992,819 E251Q probably damaging Het
Sec24b T C 3: 130,033,833 K203R possibly damaging Het
Serpina1d T A 12: 103,767,905 N47Y possibly damaging Het
Setx GTGGCT GT 2: 29,154,061 probably null Het
Sirpb1c T C 3: 15,833,123 K184R probably damaging Het
Slc16a10 G C 10: 40,056,624 H314D possibly damaging Het
Upp2 T C 2: 58,755,367 S41P probably benign Het
Vmn1r10 A G 6: 57,113,734 T104A probably damaging Het
Wdhd1 A C 14: 47,247,892 S838R possibly damaging Het
Zer1 A G 2: 30,110,911 V166A probably benign Het
Zfp217 T C 2: 170,114,388 N897D probably benign Het
Zfp960 T A 17: 17,088,371 L449H probably damaging Het
Other mutations in Mbd6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00917:Mbd6 APN 10 127284119 unclassified probably benign
IGL01685:Mbd6 APN 10 127284732 unclassified probably benign
IGL02741:Mbd6 APN 10 127287394 critical splice donor site probably null
IGL03090:Mbd6 APN 10 127287144 missense probably damaging 1.00
IGL03395:Mbd6 APN 10 127283417 missense probably damaging 1.00
R0041:Mbd6 UTSW 10 127286872 missense probably damaging 1.00
R0480:Mbd6 UTSW 10 127285873 unclassified probably benign
R0507:Mbd6 UTSW 10 127283520 unclassified probably benign
R1686:Mbd6 UTSW 10 127287417 missense probably damaging 0.99
R3418:Mbd6 UTSW 10 127286503 missense probably null 0.83
R3419:Mbd6 UTSW 10 127286503 missense probably null 0.83
R3724:Mbd6 UTSW 10 127283891 unclassified probably benign
R3742:Mbd6 UTSW 10 127284943 unclassified probably benign
R3800:Mbd6 UTSW 10 127285167 unclassified probably benign
R5023:Mbd6 UTSW 10 127286441 missense probably benign 0.16
R5024:Mbd6 UTSW 10 127286441 missense probably benign 0.16
R5053:Mbd6 UTSW 10 127286441 missense probably benign 0.16
R5056:Mbd6 UTSW 10 127286441 missense probably benign 0.16
R5568:Mbd6 UTSW 10 127283428 missense possibly damaging 0.82
R5656:Mbd6 UTSW 10 127285286 unclassified probably benign
R7607:Mbd6 UTSW 10 127285230 missense unknown
Predicted Primers PCR Primer
(F):5'- GTCACTCATACCTGGCACAC -3'
(R):5'- ATTCCTTGCTAGCAGTCTGC -3'

Sequencing Primer
(F):5'- TCATACCTGGCACACTGCTGAG -3'
(R):5'- TCTCTGCAGCAGCCAAGG -3'
Posted On2015-03-18