Mutagenetix > Incidental Mutation

Incidental Mutation 'R3731:Npas3'

271002

Institutional Source

Beutler Lab

Gene Symbol

Npas3

Ensembl Gene

ENSMUSG00000021010

Gene Name

neuronal PAS domain protein 3

Synonyms

4930423H22Rik, bHLHe12

Accession Numbers

Essential gene?

Probably essential (E-score: 0.932) question?

Stock #

R3731 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

53248677-54072175 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 53354392 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Threonine at position 40 (I40T)

Ref Sequence

ENSEMBL: ENSMUSP00000098975 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000101432] [ENSMUST00000220986] [ENSMUST00000223057] [ENSMUST00000223358]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000101432
AA Change: I40T

PolyPhen 2 Score 0.108 (Sensitivity: 0.93; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000098975
Gene: ENSMUSG00000021010
AA Change: I40T

Domain	Start	End	E-Value	Type
HLH	64	119	1.34e-6	SMART
PAS	154	220	8.69e-11	SMART
low complexity region	234	256	N/A	INTRINSIC
PAS	326	392	7.4e-5	SMART
PAC	398	441	2.46e-1	SMART
low complexity region	461	477	N/A	INTRINSIC
low complexity region	524	544	N/A	INTRINSIC
low complexity region	598	627	N/A	INTRINSIC
low complexity region	696	709	N/A	INTRINSIC
low complexity region	739	754	N/A	INTRINSIC
low complexity region	759	773	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000220986

Predicted Effect

probably benign
Transcript: ENSMUST00000223057

Predicted Effect

probably benign
Transcript: ENSMUST00000223358

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.5%
20x: 95.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the basic helix-loop-helix and PAS domain-containing family of transcription factors. The encoded protein is localized to the nucleus and may regulate genes involved in neurogenesis. Chromosomal abnormalities that affect the coding potential of this gene are associated with schizophrenia and mental retardation. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Sep 2009]
PHENOTYPE: Mice homozygous for some knock-out alleles exhibit abnormal behavior and nervous system morphology. Mice homozygous for another knock-out allele exhibit defective lung branching morphogenesis and die shortly after birth. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 49 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A630010A05Rik	T	A	16: 14,609,621		probably null	Het
Abcc5	A	T	16: 20,398,934	Y5*	probably null	Het
Acbd6	T	A	1: 155,558,725	S30T	probably benign	Het
Adar	T	C	3: 89,746,655	I325T	probably damaging	Het
Akap13	T	C	7: 75,611,377	S92P	probably benign	Het
Atp1a4	A	T	1: 172,233,961	V771E	probably damaging	Het
BC030867	A	G	11: 102,257,906	E381G	possibly damaging	Het
Cfh	A	G	1: 140,119,970	S492P	possibly damaging	Het
Crlf1	A	G	8: 70,499,442	T95A	probably benign	Het
Dennd2d	T	G	3: 106,499,955	F441V	probably damaging	Het
Dhx33	T	C	11: 70,989,152	D344G	probably benign	Het
Disp3	A	G	4: 148,252,827	S844P	probably benign	Het
Dock2	T	C	11: 34,708,895	K286E	probably damaging	Het
Fam228a	T	C	12: 4,718,671	E203G	probably benign	Het
Fbxo38	GTGCTGCTGCTGCTGCTGCTGC	GTGCTGCTGCTGCTGCTGC	18: 62,515,328		probably benign	Het
Frmpd4	G	A	X: 167,486,807	T493M	probably damaging	Het
Galnt13	A	G	2: 54,933,507	N365S	possibly damaging	Het
Ighv1-19	C	A	12: 114,708,877	C40F	probably damaging	Het
Ints4	A	G	7: 97,506,101	Q320R	probably benign	Het
Kctd5	T	C	17: 24,059,238	D146G	probably benign	Het
Loxl3	T	C	6: 83,050,671		probably null	Het
Lrp2	G	A	2: 69,464,579	P3465L	probably damaging	Het
Lrp2	A	T	2: 69,534,907		probably null	Het
Manba	G	A	3: 135,554,850	V599I	probably benign	Het
Mbd6	A	G	10: 127,285,768		probably benign	Het
Mrc2	G	A	11: 105,348,431		probably null	Het
Nepn	A	T	10: 52,404,014	N401Y	probably damaging	Het
Nol10	A	T	12: 17,424,673	K622I	probably benign	Het
Olfr348	A	T	2: 36,786,566	I14F	possibly damaging	Het
Olfr389	T	C	11: 73,776,739	E196G	probably benign	Het
Olfr498	T	C	7: 108,465,426	I34T	possibly damaging	Het
Olfr710	T	A	7: 106,944,477	N175Y	probably damaging	Het
Olfr733	T	A	14: 50,298,505	D268V	probably damaging	Het
Olfr952	T	A	9: 39,427,069	M1L	probably benign	Het
Phtf1	A	G	3: 103,985,779	M120V	probably benign	Het
Plxna2	A	G	1: 194,788,885	Y988C	probably benign	Het
Rgs12	G	A	5: 35,032,251	E658K	probably damaging	Het
Ripor3	C	G	2: 167,992,819	E251Q	probably damaging	Het
Sec24b	T	C	3: 130,033,833	K203R	possibly damaging	Het
Serpina1d	T	A	12: 103,767,905	N47Y	possibly damaging	Het
Setx	GTGGCT	GT	2: 29,154,061	1814	probably null	Het
Sirpb1c	T	C	3: 15,833,123	K184R	probably damaging	Het
Slc16a10	G	C	10: 40,056,624	H314D	possibly damaging	Het
Upp2	T	C	2: 58,755,367	S41P	probably benign	Het
Vmn1r10	A	G	6: 57,113,734	T104A	probably damaging	Het
Wdhd1	A	C	14: 47,247,892	S838R	possibly damaging	Het
Zer1	A	G	2: 30,110,911	V166A	probably benign	Het
Zfp217	T	C	2: 170,114,388	N897D	probably benign	Het
Zfp960	T	A	17: 17,088,371	L449H	probably damaging	Het

Other mutations in Npas3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01021:Npas3	APN	12	54003560	missense	probably damaging	1.00
IGL01330:Npas3	APN	12	54048819	missense	probably damaging	1.00
IGL01376:Npas3	APN	12	54044586	missense	probably benign	0.01
IGL01634:Npas3	APN	12	53947163	missense	probably damaging	1.00
IGL02456:Npas3	APN	12	54048767	missense	probably damaging	0.99
IGL02663:Npas3	APN	12	54068908	missense	probably damaging	1.00
IGL02731:Npas3	APN	12	54067795	missense	probably benign	0.01
IGL02955:Npas3	APN	12	53501265	missense	probably damaging	0.96
IGL03001:Npas3	APN	12	53501192	missense	probably damaging	1.00
IGL03047:Npas3	APN	12	53831687	splice site	probably benign
ANU05:Npas3	UTSW	12	54068074	missense	possibly damaging	0.49
IGL02837:Npas3	UTSW	12	53947197	missense	possibly damaging	0.79
R0042:Npas3	UTSW	12	54048841	missense	probably damaging	1.00
R0042:Npas3	UTSW	12	54048841	missense	probably damaging	1.00
R0396:Npas3	UTSW	12	53831745	missense	probably damaging	1.00
R1687:Npas3	UTSW	12	54048875	splice site	probably null
R1863:Npas3	UTSW	12	54068826	missense	probably damaging	1.00
R2004:Npas3	UTSW	12	54067897	missense	possibly damaging	0.63
R2047:Npas3	UTSW	12	54068829	missense	probably damaging	0.99
R2049:Npas3	UTSW	12	54062088	missense	probably damaging	1.00
R2278:Npas3	UTSW	12	53640502	missense	possibly damaging	0.92
R2323:Npas3	UTSW	12	54068346	missense	probably damaging	1.00
R2871:Npas3	UTSW	12	54068013	nonsense	probably null
R2871:Npas3	UTSW	12	54068013	nonsense	probably null
R3116:Npas3	UTSW	12	54067725	splice site	probably null
R3431:Npas3	UTSW	12	54069049	missense	probably damaging	0.99
R3767:Npas3	UTSW	12	54069074	makesense	probably null
R4332:Npas3	UTSW	12	54062069	missense	probably damaging	0.99
R4593:Npas3	UTSW	12	54068497	missense	probably benign	0.08
R4601:Npas3	UTSW	12	54044578	missense	probably damaging	0.99
R4654:Npas3	UTSW	12	54062132	critical splice donor site	probably null
R4946:Npas3	UTSW	12	54065835	missense	probably damaging	1.00
R5140:Npas3	UTSW	12	53501114	nonsense	probably null
R5302:Npas3	UTSW	12	54068836	missense	probably damaging	1.00
R5524:Npas3	UTSW	12	54068938	missense	possibly damaging	0.64
R5735:Npas3	UTSW	12	54003479	missense	probably benign	0.00
R6252:Npas3	UTSW	12	54068890	missense	probably damaging	1.00
R6438:Npas3	UTSW	12	54068698	missense	probably damaging	0.99
R6987:Npas3	UTSW	12	54068253	missense	possibly damaging	0.94
R6994:Npas3	UTSW	12	54068793	missense	probably damaging	0.96
R7304:Npas3	UTSW	12	54069041	missense	probably damaging	1.00
R7684:Npas3	UTSW	12	54068826	missense	probably damaging	1.00
R7724:Npas3	UTSW	12	54068341	missense	possibly damaging	0.90
R7739:Npas3	UTSW	12	54068718	missense	probably damaging	1.00
R7826:Npas3	UTSW	12	53831756	missense	possibly damaging	0.92
R8017:Npas3	UTSW	12	54044679	missense	probably damaging	1.00
R8019:Npas3	UTSW	12	54044679	missense	probably damaging	1.00
R8034:Npas3	UTSW	12	53640529	missense	probably damaging	1.00
R8422:Npas3	UTSW	12	54068509	missense	probably benign
R9172:Npas3	UTSW	12	54065870	missense	probably benign	0.08
R9207:Npas3	UTSW	12	54068035	missense	possibly damaging	0.87
R9774:Npas3	UTSW	12	53947325	missense	probably damaging	1.00
X0003:Npas3	UTSW	12	54044728	splice site	probably null
X0064:Npas3	UTSW	12	53354384	missense	probably damaging	0.96
Z1176:Npas3	UTSW	12	53501180	missense	probably damaging	0.99
Z1177:Npas3	UTSW	12	53947206	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GCTACAGTGTACACATTACAGTTG -3'
(R):5'- CCCACCCTTGATTTCAGAGG -3'

Sequencing Primer
(F):5'- CACATTACAGTTGTGAGTAGAGCC -3'
(R):5'- GAATAGCTGGCAACCACA -3'

Posted On

2015-03-18