Incidental Mutation 'R3731:Wdhd1'
ID271005
Institutional Source Beutler Lab
Gene Symbol Wdhd1
Ensembl Gene ENSMUSG00000037572
Gene NameWD repeat and HMG-box DNA binding protein 1
SynonymsAND-1, D630024B06Rik
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3731 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location47240944-47276857 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 47247892 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 838 (S838R)
Ref Sequence ENSEMBL: ENSMUSP00000141182 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000111791] [ENSMUST00000111792] [ENSMUST00000187531] [ENSMUST00000227041]
Predicted Effect possibly damaging
Transcript: ENSMUST00000111791
AA Change: S838R

PolyPhen 2 Score 0.827 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000107421
Gene: ENSMUSG00000037572
AA Change: S838R

DomainStartEndE-ValueType
WD40 4 41 8.62e-4 SMART
WD40 83 122 8.91e-1 SMART
WD40 125 164 1.67e-10 SMART
WD40 217 258 6.19e-1 SMART
WD40 261 301 5.11e1 SMART
low complexity region 353 363 N/A INTRINSIC
Pfam:Mcl1_mid 424 708 1.6e-103 PFAM
coiled coil region 802 834 N/A INTRINSIC
HMG 1003 1073 2.64e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111792
AA Change: S801R

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000107422
Gene: ENSMUSG00000037572
AA Change: S801R

DomainStartEndE-ValueType
WD40 4 41 8.62e-4 SMART
WD40 83 122 8.91e-1 SMART
WD40 125 164 1.67e-10 SMART
WD40 217 258 6.19e-1 SMART
WD40 261 301 5.11e1 SMART
low complexity region 316 326 N/A INTRINSIC
Pfam:DUF3639 488 514 7.1e-13 PFAM
coiled coil region 765 797 N/A INTRINSIC
HMG 966 1036 2.64e-12 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000187531
AA Change: S838R

PolyPhen 2 Score 0.892 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000141182
Gene: ENSMUSG00000037572
AA Change: S838R

DomainStartEndE-ValueType
WD40 4 41 8.62e-4 SMART
WD40 83 122 8.91e-1 SMART
WD40 125 164 1.67e-10 SMART
WD40 217 258 6.19e-1 SMART
WD40 261 301 5.11e1 SMART
low complexity region 353 363 N/A INTRINSIC
Pfam:DUF3639 525 551 3e-13 PFAM
coiled coil region 802 834 N/A INTRINSIC
HMG 1003 1073 2.64e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000227041
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228810
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains multiple N-terminal WD40 domains and a C-terminal high mobility group (HMG) box. WD40 domains are found in a variety of eukaryotic proteins and may function as adaptor/regulatory modules in signal transduction, pre-mRNA processing and cytoskeleton assembly. HMG boxes are found in many eukaryotic proteins involved in chromatin assembly, transcription and replication. Alternative splicing results in two transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A630010A05Rik T A 16: 14,609,621 probably null Het
Abcc5 A T 16: 20,398,934 Y5* probably null Het
Acbd6 T A 1: 155,558,725 S30T probably benign Het
Adar T C 3: 89,746,655 I325T probably damaging Het
Akap13 T C 7: 75,611,377 S92P probably benign Het
Atp1a4 A T 1: 172,233,961 V771E probably damaging Het
BC030867 A G 11: 102,257,906 E381G possibly damaging Het
Cfh A G 1: 140,119,970 S492P possibly damaging Het
Crlf1 A G 8: 70,499,442 T95A probably benign Het
Dennd2d T G 3: 106,499,955 F441V probably damaging Het
Dhx33 T C 11: 70,989,152 D344G probably benign Het
Disp3 A G 4: 148,252,827 S844P probably benign Het
Dock2 T C 11: 34,708,895 K286E probably damaging Het
Fam228a T C 12: 4,718,671 E203G probably benign Het
Fbxo38 GTGCTGCTGCTGCTGCTGCTGC GTGCTGCTGCTGCTGCTGC 18: 62,515,328 probably benign Het
Frmpd4 G A X: 167,486,807 T493M probably damaging Het
Galnt13 A G 2: 54,933,507 N365S possibly damaging Het
Ighv1-19 C A 12: 114,708,877 C40F probably damaging Het
Ints4 A G 7: 97,506,101 Q320R probably benign Het
Kctd5 T C 17: 24,059,238 D146G probably benign Het
Loxl3 T C 6: 83,050,671 probably null Het
Lrp2 G A 2: 69,464,579 P3465L probably damaging Het
Lrp2 A T 2: 69,534,907 probably null Het
Manba G A 3: 135,554,850 V599I probably benign Het
Mbd6 A G 10: 127,285,768 probably benign Het
Mrc2 G A 11: 105,348,431 probably null Het
Nepn A T 10: 52,404,014 N401Y probably damaging Het
Nol10 A T 12: 17,424,673 K622I probably benign Het
Npas3 T C 12: 53,354,392 I40T probably benign Het
Olfr348 A T 2: 36,786,566 I14F possibly damaging Het
Olfr389 T C 11: 73,776,739 E196G probably benign Het
Olfr498 T C 7: 108,465,426 I34T possibly damaging Het
Olfr710 T A 7: 106,944,477 N175Y probably damaging Het
Olfr733 T A 14: 50,298,505 D268V probably damaging Het
Olfr952 T A 9: 39,427,069 M1L probably benign Het
Phtf1 A G 3: 103,985,779 M120V probably benign Het
Plxna2 A G 1: 194,788,885 Y988C probably benign Het
Rgs12 G A 5: 35,032,251 E658K probably damaging Het
Ripor3 C G 2: 167,992,819 E251Q probably damaging Het
Sec24b T C 3: 130,033,833 K203R possibly damaging Het
Serpina1d T A 12: 103,767,905 N47Y possibly damaging Het
Setx GTGGCT GT 2: 29,154,061 probably null Het
Sirpb1c T C 3: 15,833,123 K184R probably damaging Het
Slc16a10 G C 10: 40,056,624 H314D possibly damaging Het
Upp2 T C 2: 58,755,367 S41P probably benign Het
Vmn1r10 A G 6: 57,113,734 T104A probably damaging Het
Zer1 A G 2: 30,110,911 V166A probably benign Het
Zfp217 T C 2: 170,114,388 N897D probably benign Het
Zfp960 T A 17: 17,088,371 L449H probably damaging Het
Other mutations in Wdhd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01335:Wdhd1 APN 14 47250782 missense possibly damaging 0.87
IGL01789:Wdhd1 APN 14 47274817 missense probably benign 0.10
IGL01981:Wdhd1 APN 14 47261450 missense probably damaging 1.00
IGL02034:Wdhd1 APN 14 47261351 missense probably benign 0.02
IGL02932:Wdhd1 APN 14 47272134 critical splice donor site probably null
IGL02966:Wdhd1 APN 14 47241644 missense possibly damaging 0.93
IGL03355:Wdhd1 APN 14 47243889 missense possibly damaging 0.78
R0165:Wdhd1 UTSW 14 47267068 missense probably benign 0.00
R0414:Wdhd1 UTSW 14 47276588 missense probably benign
R0603:Wdhd1 UTSW 14 47263586 missense probably damaging 1.00
R1503:Wdhd1 UTSW 14 47247400 missense probably benign 0.00
R1539:Wdhd1 UTSW 14 47245050 missense possibly damaging 0.63
R1541:Wdhd1 UTSW 14 47268192 nonsense probably null
R1588:Wdhd1 UTSW 14 47256236 missense probably damaging 1.00
R1686:Wdhd1 UTSW 14 47256215 missense probably damaging 1.00
R1916:Wdhd1 UTSW 14 47258577 missense possibly damaging 0.89
R1952:Wdhd1 UTSW 14 47270190 missense probably damaging 1.00
R2320:Wdhd1 UTSW 14 47274028 missense probably benign 0.06
R2421:Wdhd1 UTSW 14 47258584 missense probably benign 0.00
R3818:Wdhd1 UTSW 14 47243801 critical splice donor site probably null
R3836:Wdhd1 UTSW 14 47245054 missense probably benign 0.01
R4789:Wdhd1 UTSW 14 47268692 missense probably benign 0.01
R4963:Wdhd1 UTSW 14 47268689 missense possibly damaging 0.66
R4994:Wdhd1 UTSW 14 47268654 critical splice donor site probably null
R5225:Wdhd1 UTSW 14 47250816 missense probably benign 0.01
R5347:Wdhd1 UTSW 14 47268724 nonsense probably null
R5377:Wdhd1 UTSW 14 47272221 missense probably benign 0.15
R6038:Wdhd1 UTSW 14 47263580 missense possibly damaging 0.89
R6038:Wdhd1 UTSW 14 47263580 missense possibly damaging 0.89
R6046:Wdhd1 UTSW 14 47273210 nonsense probably null
R6156:Wdhd1 UTSW 14 47268196 missense probably damaging 0.99
R6289:Wdhd1 UTSW 14 47258496 missense possibly damaging 0.95
R6298:Wdhd1 UTSW 14 47273122 missense possibly damaging 0.67
R6345:Wdhd1 UTSW 14 47251922 missense probably damaging 0.99
R6405:Wdhd1 UTSW 14 47243867 missense possibly damaging 0.91
R6500:Wdhd1 UTSW 14 47250760 splice site probably null
R6564:Wdhd1 UTSW 14 47248042 missense probably benign
R6897:Wdhd1 UTSW 14 47248130 missense probably damaging 1.00
R7262:Wdhd1 UTSW 14 47251973 missense probably benign 0.08
R7444:Wdhd1 UTSW 14 47251948 nonsense probably null
R7496:Wdhd1 UTSW 14 47274024 missense probably benign 0.39
R7503:Wdhd1 UTSW 14 47250791 missense probably benign 0.25
R8317:Wdhd1 UTSW 14 47263537 missense probably damaging 1.00
R8323:Wdhd1 UTSW 14 47274795 missense possibly damaging 0.85
R8338:Wdhd1 UTSW 14 47268663 missense probably benign
R8363:Wdhd1 UTSW 14 47276532 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTTAGGTGACCAAAATGGCAATAC -3'
(R):5'- ATTGGCAGAAACCCAGTCAG -3'

Sequencing Primer
(F):5'- CAACTTTGTAGGCAAGAGTCAGCTC -3'
(R):5'- TGGCAGAAACCCAGTCAGAAGAAG -3'
Posted On2015-03-18