Incidental Mutation 'R3731:Zfp960'
ID271012
Institutional Source Beutler Lab
Gene Symbol Zfp960
Ensembl Gene ENSMUSG00000096696
Gene Namezinc finger protein 960
SynonymsBC018101
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.166) question?
Stock #R3731 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location17064113-17089628 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 17088371 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Histidine at position 449 (L449H)
Ref Sequence ENSEMBL: ENSMUSP00000123102 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000127027]
Predicted Effect probably damaging
Transcript: ENSMUST00000127027
AA Change: L449H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000123102
Gene: ENSMUSG00000096696
AA Change: L449H

DomainStartEndE-ValueType
KRAB 13 82 4.42e-16 SMART
ZnF_C2H2 158 180 3.95e-4 SMART
ZnF_C2H2 186 208 4.4e-2 SMART
ZnF_C2H2 238 260 2.95e-3 SMART
ZnF_C2H2 266 288 6.32e-3 SMART
ZnF_C2H2 294 316 8.94e-3 SMART
ZnF_C2H2 322 344 2.53e-2 SMART
ZnF_C2H2 350 372 3.21e-4 SMART
ZnF_C2H2 378 400 3.89e-3 SMART
ZnF_C2H2 406 428 2.2e-2 SMART
ZnF_C2H2 434 456 7.9e-4 SMART
ZnF_C2H2 462 484 7.9e-4 SMART
ZnF_C2H2 490 512 7.78e-3 SMART
ZnF_C2H2 518 540 3.95e-4 SMART
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A630010A05Rik T A 16: 14,609,621 probably null Het
Abcc5 A T 16: 20,398,934 Y5* probably null Het
Acbd6 T A 1: 155,558,725 S30T probably benign Het
Adar T C 3: 89,746,655 I325T probably damaging Het
Akap13 T C 7: 75,611,377 S92P probably benign Het
Atp1a4 A T 1: 172,233,961 V771E probably damaging Het
BC030867 A G 11: 102,257,906 E381G possibly damaging Het
Cfh A G 1: 140,119,970 S492P possibly damaging Het
Crlf1 A G 8: 70,499,442 T95A probably benign Het
Dennd2d T G 3: 106,499,955 F441V probably damaging Het
Dhx33 T C 11: 70,989,152 D344G probably benign Het
Disp3 A G 4: 148,252,827 S844P probably benign Het
Dock2 T C 11: 34,708,895 K286E probably damaging Het
Fam228a T C 12: 4,718,671 E203G probably benign Het
Fbxo38 GTGCTGCTGCTGCTGCTGCTGC GTGCTGCTGCTGCTGCTGC 18: 62,515,328 probably benign Het
Frmpd4 G A X: 167,486,807 T493M probably damaging Het
Galnt13 A G 2: 54,933,507 N365S possibly damaging Het
Ighv1-19 C A 12: 114,708,877 C40F probably damaging Het
Ints4 A G 7: 97,506,101 Q320R probably benign Het
Kctd5 T C 17: 24,059,238 D146G probably benign Het
Loxl3 T C 6: 83,050,671 probably null Het
Lrp2 G A 2: 69,464,579 P3465L probably damaging Het
Lrp2 A T 2: 69,534,907 probably null Het
Manba G A 3: 135,554,850 V599I probably benign Het
Mbd6 A G 10: 127,285,768 probably benign Het
Mrc2 G A 11: 105,348,431 probably null Het
Nepn A T 10: 52,404,014 N401Y probably damaging Het
Nol10 A T 12: 17,424,673 K622I probably benign Het
Npas3 T C 12: 53,354,392 I40T probably benign Het
Olfr348 A T 2: 36,786,566 I14F possibly damaging Het
Olfr389 T C 11: 73,776,739 E196G probably benign Het
Olfr498 T C 7: 108,465,426 I34T possibly damaging Het
Olfr710 T A 7: 106,944,477 N175Y probably damaging Het
Olfr733 T A 14: 50,298,505 D268V probably damaging Het
Olfr952 T A 9: 39,427,069 M1L probably benign Het
Phtf1 A G 3: 103,985,779 M120V probably benign Het
Plxna2 A G 1: 194,788,885 Y988C probably benign Het
Rgs12 G A 5: 35,032,251 E658K probably damaging Het
Ripor3 C G 2: 167,992,819 E251Q probably damaging Het
Sec24b T C 3: 130,033,833 K203R possibly damaging Het
Serpina1d T A 12: 103,767,905 N47Y possibly damaging Het
Setx GTGGCT GT 2: 29,154,061 probably null Het
Sirpb1c T C 3: 15,833,123 K184R probably damaging Het
Slc16a10 G C 10: 40,056,624 H314D possibly damaging Het
Upp2 T C 2: 58,755,367 S41P probably benign Het
Vmn1r10 A G 6: 57,113,734 T104A probably damaging Het
Wdhd1 A C 14: 47,247,892 S838R possibly damaging Het
Zer1 A G 2: 30,110,911 V166A probably benign Het
Zfp217 T C 2: 170,114,388 N897D probably benign Het
Other mutations in Zfp960
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1026:Zfp960 UTSW 17 17088256 missense probably damaging 1.00
R1511:Zfp960 UTSW 17 17088256 missense probably damaging 1.00
R2141:Zfp960 UTSW 17 17087884 missense probably benign 0.09
R3729:Zfp960 UTSW 17 17088371 missense probably damaging 1.00
R3730:Zfp960 UTSW 17 17088371 missense probably damaging 1.00
R4799:Zfp960 UTSW 17 17088436 missense probably damaging 1.00
R5418:Zfp960 UTSW 17 17087543 missense probably damaging 1.00
R5513:Zfp960 UTSW 17 17087734 missense possibly damaging 0.64
R6309:Zfp960 UTSW 17 17088377 missense probably benign 0.08
R6836:Zfp960 UTSW 17 17088172 missense probably damaging 1.00
R7166:Zfp960 UTSW 17 17088499 missense probably damaging 1.00
R7528:Zfp960 UTSW 17 17087563 missense possibly damaging 0.84
R7576:Zfp960 UTSW 17 17087965 missense probably benign 0.05
R8063:Zfp960 UTSW 17 17088361 missense probably benign 0.03
R8263:Zfp960 UTSW 17 17087940 nonsense probably null
R8354:Zfp960 UTSW 17 17088199 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CGTCACAGCACTCTTCAAAG -3'
(R):5'- GTACTGTGACCTGCAAAGGC -3'

Sequencing Primer
(F):5'- AAAGCCTTTGCATGTCCCAG -3'
(R):5'- GCCACACTGGTTACATTCATAGGG -3'
Posted On2015-03-18