Incidental Mutation 'R3731:Kctd5'
ID271013
Institutional Source Beutler Lab
Gene Symbol Kctd5
Ensembl Gene ENSMUSG00000016946
Gene Namepotassium channel tetramerisation domain containing 5
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.217) question?
Stock #R3731 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location24047734-24073485 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 24059238 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 146 (D146G)
Ref Sequence ENSEMBL: ENSMUSP00000017090 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000017090]
Predicted Effect probably benign
Transcript: ENSMUST00000017090
AA Change: D146G

PolyPhen 2 Score 0.018 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000017090
Gene: ENSMUSG00000016946
AA Change: D146G

DomainStartEndE-ValueType
low complexity region 8 31 N/A INTRINSIC
BTB 44 146 2.76e-18 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127755
Meta Mutation Damage Score 0.1844 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A630010A05Rik T A 16: 14,609,621 probably null Het
Abcc5 A T 16: 20,398,934 Y5* probably null Het
Acbd6 T A 1: 155,558,725 S30T probably benign Het
Adar T C 3: 89,746,655 I325T probably damaging Het
Akap13 T C 7: 75,611,377 S92P probably benign Het
Atp1a4 A T 1: 172,233,961 V771E probably damaging Het
BC030867 A G 11: 102,257,906 E381G possibly damaging Het
Cfh A G 1: 140,119,970 S492P possibly damaging Het
Crlf1 A G 8: 70,499,442 T95A probably benign Het
Dennd2d T G 3: 106,499,955 F441V probably damaging Het
Dhx33 T C 11: 70,989,152 D344G probably benign Het
Disp3 A G 4: 148,252,827 S844P probably benign Het
Dock2 T C 11: 34,708,895 K286E probably damaging Het
Fam228a T C 12: 4,718,671 E203G probably benign Het
Fbxo38 GTGCTGCTGCTGCTGCTGCTGC GTGCTGCTGCTGCTGCTGC 18: 62,515,328 probably benign Het
Frmpd4 G A X: 167,486,807 T493M probably damaging Het
Galnt13 A G 2: 54,933,507 N365S possibly damaging Het
Ighv1-19 C A 12: 114,708,877 C40F probably damaging Het
Ints4 A G 7: 97,506,101 Q320R probably benign Het
Loxl3 T C 6: 83,050,671 probably null Het
Lrp2 G A 2: 69,464,579 P3465L probably damaging Het
Lrp2 A T 2: 69,534,907 probably null Het
Manba G A 3: 135,554,850 V599I probably benign Het
Mbd6 A G 10: 127,285,768 probably benign Het
Mrc2 G A 11: 105,348,431 probably null Het
Nepn A T 10: 52,404,014 N401Y probably damaging Het
Nol10 A T 12: 17,424,673 K622I probably benign Het
Npas3 T C 12: 53,354,392 I40T probably benign Het
Olfr348 A T 2: 36,786,566 I14F possibly damaging Het
Olfr389 T C 11: 73,776,739 E196G probably benign Het
Olfr498 T C 7: 108,465,426 I34T possibly damaging Het
Olfr710 T A 7: 106,944,477 N175Y probably damaging Het
Olfr733 T A 14: 50,298,505 D268V probably damaging Het
Olfr952 T A 9: 39,427,069 M1L probably benign Het
Phtf1 A G 3: 103,985,779 M120V probably benign Het
Plxna2 A G 1: 194,788,885 Y988C probably benign Het
Rgs12 G A 5: 35,032,251 E658K probably damaging Het
Ripor3 C G 2: 167,992,819 E251Q probably damaging Het
Sec24b T C 3: 130,033,833 K203R possibly damaging Het
Serpina1d T A 12: 103,767,905 N47Y possibly damaging Het
Setx GTGGCT GT 2: 29,154,061 probably null Het
Sirpb1c T C 3: 15,833,123 K184R probably damaging Het
Slc16a10 G C 10: 40,056,624 H314D possibly damaging Het
Upp2 T C 2: 58,755,367 S41P probably benign Het
Vmn1r10 A G 6: 57,113,734 T104A probably damaging Het
Wdhd1 A C 14: 47,247,892 S838R possibly damaging Het
Zer1 A G 2: 30,110,911 V166A probably benign Het
Zfp217 T C 2: 170,114,388 N897D probably benign Het
Zfp960 T A 17: 17,088,371 L449H probably damaging Het
Other mutations in Kctd5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01339:Kctd5 APN 17 24057775 missense probably damaging 1.00
IGL01393:Kctd5 APN 17 24059318 splice site probably null
R0381:Kctd5 UTSW 17 24059220 critical splice donor site probably null
R2121:Kctd5 UTSW 17 24055966 missense probably benign
R2122:Kctd5 UTSW 17 24055966 missense probably benign
R3729:Kctd5 UTSW 17 24059238 missense probably benign 0.02
R3730:Kctd5 UTSW 17 24059238 missense probably benign 0.02
R7203:Kctd5 UTSW 17 24073235 missense probably benign 0.26
Predicted Primers PCR Primer
(F):5'- TCCACTGATGGCCCTTCATG -3'
(R):5'- TGACACAAGAACCTCAGGTTAGAG -3'

Sequencing Primer
(F):5'- ACAGTTCTGGTCCAAGGT -3'
(R):5'- TTGGTCTGATCTAGAAGAAGCTCAG -3'
Posted On2015-03-18