Incidental Mutation 'R3731:Frmpd4'
ID271015
Institutional Source Beutler Lab
Gene Symbol Frmpd4
Ensembl Gene ENSMUSG00000049176
Gene NameFERM and PDZ domain containing 4
SynonymsPreso1, Pdzk10, LOC237234, Pdzd10, PKAP1, Preso
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3731 (G1)
Quality Score222
Status Not validated
ChromosomeX
Chromosomal Location167471309-168577231 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 167486807 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 493 (T493M)
Ref Sequence ENSEMBL: ENSMUSP00000107774 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000112145] [ENSMUST00000112146] [ENSMUST00000112147] [ENSMUST00000112149]
Predicted Effect probably benign
Transcript: ENSMUST00000112145
AA Change: T525M

PolyPhen 2 Score 0.415 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000107773
Gene: ENSMUSG00000049176
AA Change: T525M

DomainStartEndE-ValueType
PDZ 77 147 1.38e-12 SMART
B41 194 416 1.86e-49 SMART
low complexity region 734 745 N/A INTRINSIC
low complexity region 762 775 N/A INTRINSIC
Blast:B41 794 864 9e-6 BLAST
low complexity region 865 874 N/A INTRINSIC
low complexity region 892 905 N/A INTRINSIC
low complexity region 1210 1224 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000112146
AA Change: T493M

PolyPhen 2 Score 0.965 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000107774
Gene: ENSMUSG00000049176
AA Change: T493M

DomainStartEndE-ValueType
PDZ 45 115 1.38e-12 SMART
B41 162 384 1.86e-49 SMART
low complexity region 702 713 N/A INTRINSIC
low complexity region 730 743 N/A INTRINSIC
Blast:B41 762 832 1e-5 BLAST
low complexity region 833 842 N/A INTRINSIC
low complexity region 860 873 N/A INTRINSIC
low complexity region 1178 1192 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112147
AA Change: T525M

PolyPhen 2 Score 0.415 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000107775
Gene: ENSMUSG00000049176
AA Change: T525M

DomainStartEndE-ValueType
PDZ 77 147 1.38e-12 SMART
B41 194 416 1.86e-49 SMART
low complexity region 734 745 N/A INTRINSIC
low complexity region 762 775 N/A INTRINSIC
Blast:B41 794 864 9e-6 BLAST
low complexity region 865 874 N/A INTRINSIC
low complexity region 892 905 N/A INTRINSIC
low complexity region 1210 1224 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000112149
AA Change: T533M

PolyPhen 2 Score 0.816 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000107777
Gene: ENSMUSG00000049176
AA Change: T533M

DomainStartEndE-ValueType
PDZ 85 155 1.38e-12 SMART
B41 202 424 1.86e-49 SMART
low complexity region 742 753 N/A INTRINSIC
low complexity region 770 783 N/A INTRINSIC
Blast:B41 802 872 1e-5 BLAST
low complexity region 873 882 N/A INTRINSIC
low complexity region 900 913 N/A INTRINSIC
low complexity region 1218 1232 N/A INTRINSIC
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a multi-domain (WW, PDZ, FERM) containing protein. Through its interaction with other proteins (such as PSD-95), it functions as a positive regulator of dendritic spine morphogenesis and density, and is required for the maintenance of excitatory synaptic transmission. [provided by RefSeq, Jan 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased inflammation-induced pain and thermal pain in a chronic pain model. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A630010A05Rik T A 16: 14,609,621 probably null Het
Abcc5 A T 16: 20,398,934 Y5* probably null Het
Acbd6 T A 1: 155,558,725 S30T probably benign Het
Adar T C 3: 89,746,655 I325T probably damaging Het
Akap13 T C 7: 75,611,377 S92P probably benign Het
Atp1a4 A T 1: 172,233,961 V771E probably damaging Het
BC030867 A G 11: 102,257,906 E381G possibly damaging Het
Cfh A G 1: 140,119,970 S492P possibly damaging Het
Crlf1 A G 8: 70,499,442 T95A probably benign Het
Dennd2d T G 3: 106,499,955 F441V probably damaging Het
Dhx33 T C 11: 70,989,152 D344G probably benign Het
Disp3 A G 4: 148,252,827 S844P probably benign Het
Dock2 T C 11: 34,708,895 K286E probably damaging Het
Fam228a T C 12: 4,718,671 E203G probably benign Het
Fbxo38 GTGCTGCTGCTGCTGCTGCTGC GTGCTGCTGCTGCTGCTGC 18: 62,515,328 probably benign Het
Galnt13 A G 2: 54,933,507 N365S possibly damaging Het
Ighv1-19 C A 12: 114,708,877 C40F probably damaging Het
Ints4 A G 7: 97,506,101 Q320R probably benign Het
Kctd5 T C 17: 24,059,238 D146G probably benign Het
Loxl3 T C 6: 83,050,671 probably null Het
Lrp2 G A 2: 69,464,579 P3465L probably damaging Het
Lrp2 A T 2: 69,534,907 probably null Het
Manba G A 3: 135,554,850 V599I probably benign Het
Mbd6 A G 10: 127,285,768 probably benign Het
Mrc2 G A 11: 105,348,431 probably null Het
Nepn A T 10: 52,404,014 N401Y probably damaging Het
Nol10 A T 12: 17,424,673 K622I probably benign Het
Npas3 T C 12: 53,354,392 I40T probably benign Het
Olfr348 A T 2: 36,786,566 I14F possibly damaging Het
Olfr389 T C 11: 73,776,739 E196G probably benign Het
Olfr498 T C 7: 108,465,426 I34T possibly damaging Het
Olfr710 T A 7: 106,944,477 N175Y probably damaging Het
Olfr733 T A 14: 50,298,505 D268V probably damaging Het
Olfr952 T A 9: 39,427,069 M1L probably benign Het
Phtf1 A G 3: 103,985,779 M120V probably benign Het
Plxna2 A G 1: 194,788,885 Y988C probably benign Het
Rgs12 G A 5: 35,032,251 E658K probably damaging Het
Ripor3 C G 2: 167,992,819 E251Q probably damaging Het
Sec24b T C 3: 130,033,833 K203R possibly damaging Het
Serpina1d T A 12: 103,767,905 N47Y possibly damaging Het
Setx GTGGCT GT 2: 29,154,061 probably null Het
Sirpb1c T C 3: 15,833,123 K184R probably damaging Het
Slc16a10 G C 10: 40,056,624 H314D possibly damaging Het
Upp2 T C 2: 58,755,367 S41P probably benign Het
Vmn1r10 A G 6: 57,113,734 T104A probably damaging Het
Wdhd1 A C 14: 47,247,892 S838R possibly damaging Het
Zer1 A G 2: 30,110,911 V166A probably benign Het
Zfp217 T C 2: 170,114,388 N897D probably benign Het
Zfp960 T A 17: 17,088,371 L449H probably damaging Het
Other mutations in Frmpd4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02227:Frmpd4 APN X 167492935 missense probably damaging 1.00
IGL02476:Frmpd4 APN X 167497855 missense probably damaging 1.00
IGL03142:Frmpd4 APN X 167479483 missense possibly damaging 0.86
IGL03292:Frmpd4 APN X 167477590 missense probably benign
PIT4283001:Frmpd4 UTSW X 167729034 missense possibly damaging 0.95
R0647:Frmpd4 UTSW X 167489010 missense probably damaging 1.00
R1520:Frmpd4 UTSW X 167492953 missense probably damaging 1.00
R2869:Frmpd4 UTSW X 167477247 missense probably benign 0.24
R2869:Frmpd4 UTSW X 167477247 missense probably benign 0.24
R2871:Frmpd4 UTSW X 167477247 missense probably benign 0.24
R2871:Frmpd4 UTSW X 167477247 missense probably benign 0.24
R2872:Frmpd4 UTSW X 167477247 missense probably benign 0.24
R2872:Frmpd4 UTSW X 167477247 missense probably benign 0.24
R2874:Frmpd4 UTSW X 167477247 missense probably benign 0.24
R3729:Frmpd4 UTSW X 167486807 missense probably damaging 0.96
R6943:Frmpd4 UTSW X 167604583 missense probably damaging 1.00
Z1088:Frmpd4 UTSW X 167497840 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCCCATGATTGTGTGGAATG -3'
(R):5'- GCTTCTCCAGAGGAATATTTTCTC -3'

Sequencing Primer
(F):5'- CCCCATGATTGTGTGGAATGTATTTC -3'
(R):5'- ATCAGACGCCATGAACCT -3'
Posted On2015-03-18