Incidental Mutation 'R3732:D1Pas1'
ID271017
Institutional Source Beutler Lab
Gene Symbol D1Pas1
Ensembl Gene ENSMUSG00000039224
Gene NameDNA segment, Chr 1, Pasteur Institute 1
SynonymsPl10
MMRRC Submission 040720-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3732 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location186967416-186970627 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 186968097 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 74 (S74R)
Ref Sequence ENSEMBL: ENSMUSP00000035261 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045108]
Predicted Effect probably benign
Transcript: ENSMUST00000045108
AA Change: S74R

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000035261
Gene: ENSMUSG00000039224
AA Change: S74R

DomainStartEndE-ValueType
low complexity region 10 21 N/A INTRINSIC
low complexity region 80 102 N/A INTRINSIC
low complexity region 104 122 N/A INTRINSIC
DEXDc 198 417 9.08e-66 SMART
HELICc 454 535 1.23e-35 SMART
low complexity region 580 596 N/A INTRINSIC
low complexity region 598 654 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191895
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 100% (44/44)
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006E09Rik C T 11: 101,988,452 Q17* probably null Het
Ablim1 A T 19: 57,049,460 probably null Het
Adgrl3 C A 5: 81,794,946 H1474Q probably benign Het
Adgrv1 T C 13: 81,556,956 I1578M probably damaging Het
Arhgef10l AGAGGAGGAGGAGGAGGA AGAGGAGGAGGAGGA 4: 140,581,619 probably benign Het
Bcl7b A G 5: 135,180,913 T141A probably benign Het
Chrna3 T C 9: 55,015,894 K210R probably benign Het
Cpsf2 T C 12: 101,987,308 I199T probably damaging Het
Cyp2a4 A G 7: 26,312,827 D345G probably damaging Het
Cyp2s1 C T 7: 25,803,954 R424Q probably null Het
Edem1 T C 6: 108,841,621 F197L probably damaging Het
Ergic2 T C 6: 148,202,522 D79G probably damaging Het
Espl1 A G 15: 102,312,989 I944V probably damaging Het
Fat1 T C 8: 44,953,269 V1019A possibly damaging Het
Fbxl21 T A 13: 56,527,017 H60Q probably benign Het
Fbxw7 A C 3: 84,925,707 K19Q possibly damaging Het
Gldn A G 9: 54,338,662 K499R possibly damaging Het
Gria4 C T 9: 4,513,295 M271I probably benign Het
Herc1 C T 9: 66,445,640 T2136I probably damaging Het
Iqcg G T 16: 33,053,626 probably benign Het
Itih2 A T 2: 10,105,670 F537I probably benign Het
Itpr2 T C 6: 146,382,700 D533G probably damaging Het
Kcnk15 A G 2: 163,853,813 K22E probably benign Het
Lag3 A T 6: 124,910,140 S155T probably benign Het
Lars T C 18: 42,212,602 E1003G probably benign Het
Layn T A 9: 51,059,544 N233I probably damaging Het
Lgi1 T C 19: 38,306,246 Y465H probably damaging Het
Lrig1 C T 6: 94,611,576 A531T possibly damaging Het
Mtx2 C A 2: 74,847,262 A22E probably damaging Het
Nipal3 T C 4: 135,463,846 T325A probably damaging Het
Ola1 G C 2: 73,156,860 R143G probably damaging Het
Otog A G 7: 46,288,368 T1834A probably benign Het
Panx1 GTTCTTCT GTTCT 9: 15,006,171 probably benign Het
Pcdh18 T C 3: 49,754,791 S692G probably benign Het
Pkd2 G A 5: 104,489,419 probably null Het
Ppp1r9a T C 6: 4,906,259 probably benign Het
Robo2 A C 16: 73,920,747 L1159W possibly damaging Het
Sfxn5 T C 6: 85,299,276 probably benign Het
Shf T A 2: 122,345,207 probably benign Het
Siah2 A G 3: 58,676,250 V205A probably damaging Het
Slc44a4 G A 17: 34,921,561 silent Het
Spindoc A C 19: 7,374,301 L202R probably damaging Het
Spock3 T A 8: 63,345,699 D251E probably damaging Het
Stk4 T A 2: 164,088,908 M143K probably benign Het
Trpc3 A T 3: 36,638,559 D761E probably benign Het
Twf1 A C 15: 94,584,414 probably benign Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Vps50 T C 6: 3,519,243 silent Het
Wapl G A 14: 34,736,764 V928I probably damaging Het
Zfand3 A G 17: 30,192,656 K130R probably benign Het
Other mutations in D1Pas1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00816:D1Pas1 APN 1 186969412 missense possibly damaging 0.55
IGL00921:D1Pas1 APN 1 186968786 missense probably benign 0.44
R1693:D1Pas1 UTSW 1 186968029 missense probably benign
R2029:D1Pas1 UTSW 1 186968089 missense possibly damaging 0.53
R3732:D1Pas1 UTSW 1 186968097 missense probably benign 0.00
R3733:D1Pas1 UTSW 1 186968097 missense probably benign 0.00
R3930:D1Pas1 UTSW 1 186968280 missense probably damaging 1.00
R5302:D1Pas1 UTSW 1 186969445 missense probably damaging 1.00
R5815:D1Pas1 UTSW 1 186968009 missense probably damaging 1.00
R6705:D1Pas1 UTSW 1 186968379 missense probably benign 0.00
R7023:D1Pas1 UTSW 1 186968008 missense probably damaging 0.96
R7747:D1Pas1 UTSW 1 186968677 missense probably benign 0.08
R7862:D1Pas1 UTSW 1 186968152 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTTCAGGGATGAGTCATGTGGC -3'
(R):5'- GTCTGCTTTGTCACACCAGC -3'

Sequencing Primer
(F):5'- TGTGGCAGAGGAAGATGAGCTC -3'
(R):5'- TTGTCACACCAGCGACTG -3'
Posted On2015-03-18