Mutagenetix > Incidental Mutations

Incidental Mutation 'R3732:Gria4'

271043

Institutional Source

Beutler Lab

Gene Symbol

Gria4

Ensembl Gene

ENSMUSG00000025892

Gene Name

glutamate receptor, ionotropic, AMPA4 (alpha 4)

Synonyms

Gluralpha4, spkw1, Glur4, Glur-4

MMRRC Submission

040720-MU

Accession Numbers

Is this an essential gene?

Possibly essential (E-score: 0.667) question?

Stock #

R3732 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

4417896-4796234 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 4513295 bp

Zygosity

Heterozygous

Amino Acid Change

Methionine to Isoleucine at position 271 (M271I)

Ref Sequence

ENSEMBL: ENSMUSP00000148533 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000027020] [ENSMUST00000063508] [ENSMUST00000163309] [ENSMUST00000212533]

Predicted Effect

probably benign
Transcript: ENSMUST00000027020
AA Change: M271I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000027020
Gene: ENSMUSG00000025892
AA Change: M271I

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
Pfam:ANF_receptor	39	380	3e-61	PFAM
PBPe	416	791	8.23e-129	SMART
Lig_chan-Glu_bd	426	491	3.4e-31	SMART
low complexity region	821	833	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000063508
AA Change: M271I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000066980
Gene: ENSMUSG00000025892
AA Change: M271I

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
Pfam:ANF_receptor	39	380	2.5e-71	PFAM
PBPe	416	791	2.06e-129	SMART
Lig_chan-Glu_bd	426	491	3.4e-31	SMART
low complexity region	821	833	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000163309
AA Change: M271I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000129316
Gene: ENSMUSG00000025892
AA Change: M271I

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
Pfam:ANF_receptor	39	380	3.2e-62	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000212533
AA Change: M271I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

Meta Mutation Damage Score

0.07

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 94.8%

Validation Efficiency

100% (44/44)

MGI Phenotype

FUNCTION: Glutamate receptors are the predominant excitatory neurotransmitter receptors in the mammalian brain and are activated in a variety of normal neurophysiologic processes. These receptors are heteromeric protein complexes composed of multiple subunits, arranged to form ligand-gated ion channels. The classification of glutamate receptors is based on their activation by different pharmacologic agonists. The subunit encoded by this gene belongs to a family of AMPA (alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate)-sensitive glutamate receptors, and is subject to RNA editing (AGA->GGA; R->G). Alternative splicing of this gene results in transcript variants encoding different isoforms, which may vary in their signal transduction properties. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted mutation display hyperactivity, decreased thermal nociception, and abnormal sensitivity to pharmacologically induced seizures. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 50 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700006E09Rik	C	T	11: 101,988,452	Q17*	probably null	Het
Ablim1	A	T	19: 57,049,460		probably null	Het
Adgrl3	C	A	5: 81,794,946	H1474Q	probably benign	Het
Adgrv1	T	C	13: 81,556,956	I1578M	probably damaging	Het
Arhgef10l	AGAGGAGGAGGAGGAGGA	AGAGGAGGAGGAGGA	4: 140,581,619		probably benign	Het
Bcl7b	A	G	5: 135,180,913	T141A	probably benign	Het
Chrna3	T	C	9: 55,015,894	K210R	probably benign	Het
Cpsf2	T	C	12: 101,987,308	I199T	probably damaging	Het
Cyp2a4	A	G	7: 26,312,827	D345G	probably damaging	Het
Cyp2s1	C	T	7: 25,803,954	R424Q	probably null	Het
D1Pas1	C	A	1: 186,968,097	S74R	probably benign	Het
Edem1	T	C	6: 108,841,621	F197L	probably damaging	Het
Ergic2	T	C	6: 148,202,522	D79G	probably damaging	Het
Espl1	A	G	15: 102,312,989	I944V	probably damaging	Het
Fat1	T	C	8: 44,953,269	V1019A	possibly damaging	Het
Fbxl21	T	A	13: 56,527,017	H60Q	probably benign	Het
Fbxw7	A	C	3: 84,925,707	K19Q	possibly damaging	Het
Gldn	A	G	9: 54,338,662	K499R	possibly damaging	Het
Herc1	C	T	9: 66,445,640	T2136I	probably damaging	Het
Iqcg	G	T	16: 33,053,626		probably benign	Het
Itih2	A	T	2: 10,105,670	F537I	probably benign	Het
Itpr2	T	C	6: 146,382,700	D533G	probably damaging	Het
Kcnk15	A	G	2: 163,853,813	K22E	probably benign	Het
Lag3	A	T	6: 124,910,140	S155T	probably benign	Het
Lars	T	C	18: 42,212,602	E1003G	probably benign	Het
Layn	T	A	9: 51,059,544	N233I	probably damaging	Het
Lgi1	T	C	19: 38,306,246	Y465H	probably damaging	Het
Lrig1	C	T	6: 94,611,576	A531T	possibly damaging	Het
Mtx2	C	A	2: 74,847,262	A22E	probably damaging	Het
Nipal3	T	C	4: 135,463,846	T325A	probably damaging	Het
Ola1	G	C	2: 73,156,860	R143G	probably damaging	Het
Otog	A	G	7: 46,288,368	T1834A	probably benign	Het
Panx1	GTTCTTCT	GTTCT	9: 15,006,171		probably benign	Het
Pcdh18	T	C	3: 49,754,791	S692G	probably benign	Het
Pkd2	G	A	5: 104,489,419		probably null	Het
Ppp1r9a	T	C	6: 4,906,259		probably benign	Het
Robo2	A	C	16: 73,920,747	L1159W	possibly damaging	Het
Sfxn5	T	C	6: 85,299,276		probably benign	Het
Shf	T	A	2: 122,345,207		probably benign	Het
Siah2	A	G	3: 58,676,250	V205A	probably damaging	Het
Slc44a4	G	A	17: 34,921,561		silent	Het
Spindoc	A	C	19: 7,374,301	L202R	probably damaging	Het
Spock3	T	A	8: 63,345,699	D251E	probably damaging	Het
Stk4	T	A	2: 164,088,908	M143K	probably benign	Het
Trpc3	A	T	3: 36,638,559	D761E	probably benign	Het
Twf1	A	C	15: 94,584,414		probably benign	Het
Ugcg	C	T	4: 59,207,798	P46S	probably benign	Het
Vps50	T	C	6: 3,519,243		silent	Het
Wapl	G	A	14: 34,736,764	V928I	probably damaging	Het
Zfand3	A	G	17: 30,192,656	K130R	probably benign	Het

Other mutations in Gria4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00814:Gria4	APN	9	4472202	missense	probably damaging	0.98
IGL01451:Gria4	APN	9	4503652	missense	probably benign	0.04
IGL01533:Gria4	APN	9	4502395	missense	probably damaging	1.00
IGL01994:Gria4	APN	9	4537726	missense	probably damaging	1.00
IGL02078:Gria4	APN	9	4793878	missense	probably damaging	0.98
IGL02183:Gria4	APN	9	4502460	missense	probably damaging	1.00
IGL02351:Gria4	APN	9	4456206	missense	possibly damaging	0.84
IGL02358:Gria4	APN	9	4456206	missense	possibly damaging	0.84
IGL03118:Gria4	APN	9	4793804	splice site	probably benign
IGL03131:Gria4	APN	9	4432876	missense	probably damaging	0.96
IGL03148:Gria4	APN	9	4464295	missense	possibly damaging	0.91
IGL03264:Gria4	APN	9	4513288	missense	probably benign
PIT4812001:Gria4	UTSW	9	4427128	missense	probably damaging	1.00
R0018:Gria4	UTSW	9	4432843	missense	possibly damaging	0.71
R0295:Gria4	UTSW	9	4793840	missense	possibly damaging	0.69
R0654:Gria4	UTSW	9	4464372	missense	probably benign	0.32
R0690:Gria4	UTSW	9	4427071	missense	probably damaging	1.00
R0992:Gria4	UTSW	9	4795238	missense	probably benign
R1517:Gria4	UTSW	9	4793865	missense	probably damaging	1.00
R1673:Gria4	UTSW	9	4537637	nonsense	probably null
R1713:Gria4	UTSW	9	4424448	missense	probably benign	0.20
R1961:Gria4	UTSW	9	4519546	splice site	probably benign
R2137:Gria4	UTSW	9	4427026	intron	probably benign
R2397:Gria4	UTSW	9	4537717	missense	probably damaging	1.00
R2870:Gria4	UTSW	9	4503614	missense	probably damaging	0.96
R2870:Gria4	UTSW	9	4503614	missense	probably damaging	0.96
R3014:Gria4	UTSW	9	4464294	missense	probably damaging	0.97
R3412:Gria4	UTSW	9	4513278	missense	probably benign	0.00
R3732:Gria4	UTSW	9	4513295	missense	probably benign
R3733:Gria4	UTSW	9	4513295	missense	probably benign
R3897:Gria4	UTSW	9	4513260	missense	probably damaging	1.00
R4404:Gria4	UTSW	9	4464489	splice site	probably null
R4457:Gria4	UTSW	9	4427074	missense	probably damaging	1.00
R4672:Gria4	UTSW	9	4664981	missense	possibly damaging	0.96
R4865:Gria4	UTSW	9	4464295	missense	possibly damaging	0.91
R5092:Gria4	UTSW	9	4472176	missense	probably benign	0.01
R5109:Gria4	UTSW	9	4472168	missense	probably damaging	1.00
R5202:Gria4	UTSW	9	4424330	missense	probably benign	0.10
R5828:Gria4	UTSW	9	4432832	missense	probably damaging	1.00
R5945:Gria4	UTSW	9	4456122	missense	probably damaging	1.00
R5985:Gria4	UTSW	9	4503593	missense	probably damaging	0.99
R6036:Gria4	UTSW	9	4537646	missense	probably benign	0.00
R6036:Gria4	UTSW	9	4537646	missense	probably benign	0.00
R6111:Gria4	UTSW	9	4502430	missense	probably damaging	1.00
R6190:Gria4	UTSW	9	4420199	missense	probably benign
R6280:Gria4	UTSW	9	4456072	missense	probably damaging	1.00
R6406:Gria4	UTSW	9	4427077	missense	probably damaging	1.00
R6470:Gria4	UTSW	9	4503680	missense	probably damaging	1.00
R6485:Gria4	UTSW	9	4464249	missense	probably damaging	1.00
R6612:Gria4	UTSW	9	4472206	missense	possibly damaging	0.93
R6848:Gria4	UTSW	9	4793822	missense	probably damaging	1.00
R7046:Gria4	UTSW	9	4420278	missense	probably damaging	0.97
R7210:Gria4	UTSW	9	4464135	missense	probably damaging	1.00
R7284:Gria4	UTSW	9	4472017	missense	probably damaging	1.00
R7475:Gria4	UTSW	9	4513330	missense	probably damaging	1.00
R7501:Gria4	UTSW	9	4502436	missense	probably benign	0.01
R7536:Gria4	UTSW	9	4464298	missense	probably damaging	1.00
X0023:Gria4	UTSW	9	4427067	missense	probably damaging	1.00
X0065:Gria4	UTSW	9	4464340	missense	possibly damaging	0.83

Predicted Primers

PCR Primer
(F):5'- TTGGCTTGGCAGTTAAGAAAAC -3'
(R):5'- TTTCTTCTTAGATCAACAGGCATGG -3'

Sequencing Primer
(F):5'- TGCTCTTCCAAAGGTCCAGAG -3'
(R):5'- ACAGGCATGGAATTATACAAACTC -3'

Posted On

2015-03-18