Mutagenetix > Incidental Mutations

Incidental Mutation 'R3745:Trpm8'

271145

Institutional Source

Beutler Lab

Gene Symbol

Trpm8

Ensembl Gene

ENSMUSG00000036251

Gene Name

transient receptor potential cation channel, subfamily M, member 8

Synonyms

CMR1, Trp-p8, TRPP8

MMRRC Submission

040731-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.227) question?

Stock #

R3745 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

88277661-88389293 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 88348327 bp

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 549 (E549G)

Ref Sequence

ENSEMBL: ENSMUSP00000131209 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000040210] [ENSMUST00000113114] [ENSMUST00000171176]

Predicted Effect

probably benign
Transcript: ENSMUST00000040210
AA Change: E549G

PolyPhen 2 Score 0.206 (Sensitivity: 0.92; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000036991
Gene: ENSMUSG00000036251
AA Change: E549G

Domain	Start	End	E-Value	Type
low complexity region	25	40	N/A	INTRINSIC
transmembrane domain	693	712	N/A	INTRINSIC
transmembrane domain	724	758	N/A	INTRINSIC
Pfam:Ion_trans	769	979	4.7e-10	PFAM
low complexity region	1026	1036	N/A	INTRINSIC
coiled coil region	1069	1104	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000113114
AA Change: E549G

PolyPhen 2 Score 0.206 (Sensitivity: 0.92; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000108739
Gene: ENSMUSG00000036251
AA Change: E549G

Domain	Start	End	E-Value	Type
low complexity region	25	40	N/A	INTRINSIC
transmembrane domain	693	712	N/A	INTRINSIC
transmembrane domain	724	758	N/A	INTRINSIC
Pfam:Ion_trans	769	979	4.7e-10	PFAM
low complexity region	1026	1036	N/A	INTRINSIC
coiled coil region	1069	1104	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000147594

Predicted Effect

probably benign
Transcript: ENSMUST00000171176
AA Change: E549G

PolyPhen 2 Score 0.206 (Sensitivity: 0.92; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000131209
Gene: ENSMUSG00000036251
AA Change: E549G

Domain	Start	End	E-Value	Type
low complexity region	25	40	N/A	INTRINSIC
transmembrane domain	693	712	N/A	INTRINSIC
transmembrane domain	724	758	N/A	INTRINSIC
transmembrane domain	763	780	N/A	INTRINSIC
transmembrane domain	793	815	N/A	INTRINSIC
transmembrane domain	825	847	N/A	INTRINSIC
transmembrane domain	867	889	N/A	INTRINSIC
transmembrane domain	954	976	N/A	INTRINSIC
low complexity region	1026	1036	N/A	INTRINSIC
coiled coil region	1069	1104	N/A	INTRINSIC

Meta Mutation Damage Score

0.1704

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 94.8%

Validation Efficiency

98% (44/45)

MGI Phenotype

PHENOTYPE: Mice homozygous for a null allele exhibit decreased sensitivity to cold and reduced response to cold stimuli. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 44 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700012B07Rik	G	T	11: 109,794,154	C172*	probably null	Het
Acot9	G	A	X: 155,271,945		probably benign	Het
Akap10	A	G	11: 61,915,305	V199A	probably benign	Het
Aox4	C	T	1: 58,245,870	H594Y	probably damaging	Het
Arhgap35	A	T	7: 16,563,722	Y473N	probably damaging	Het
Aspn	G	A	13: 49,566,560	E351K	probably damaging	Het
Astn1	G	T	1: 158,502,060	A162S	probably damaging	Het
Auts2	A	G	5: 131,476,587		probably benign	Het
Cog6	A	T	3: 52,992,819	M507K	probably benign	Het
Crct1	C	A	3: 93,014,707		probably benign	Het
Cyp2d11	A	C	15: 82,391,855	I175S	probably benign	Het
Dclk1	A	G	3: 55,247,442	N98D	possibly damaging	Het
Erich5	T	A	15: 34,470,732	C36S	probably damaging	Het
F5	A	G	1: 164,186,779	I540V	possibly damaging	Het
Fam20a	A	T	11: 109,677,790	S303R	probably benign	Het
Fam214a	T	C	9: 75,009,862	V581A	probably benign	Het
Fat3	G	A	9: 15,998,271	S2145F	probably damaging	Het
Gbp9	C	A	5: 105,105,858		probably benign	Het
Gm6408	G	T	5: 146,484,436	V292F	probably damaging	Het
Kmt2a	A	G	9: 44,831,340		probably benign	Het
Lrriq1	T	C	10: 103,170,856	D1136G	probably damaging	Het
Macrod2	C	A	2: 141,810,629	T204K	probably damaging	Het
Mlkl	A	G	8: 111,315,567		probably benign	Het
Msantd1	T	A	5: 34,923,467	V155E	possibly damaging	Het
Myo3b	A	G	2: 70,234,485		probably benign	Het
Nbn	T	A	4: 15,976,163	C375S	possibly damaging	Het
Nell2	A	C	15: 95,432,673	C231W	probably damaging	Het
Nipbl	A	G	15: 8,358,874	S421P	probably benign	Het
Npr3	A	T	15: 11,905,491	V50E	probably damaging	Het
Olfr1425	A	G	19: 12,074,380	L84P	probably damaging	Het
Pclo	T	C	5: 14,678,421		probably benign	Het
Pkn3	A	G	2: 30,090,341	K785R	probably damaging	Het
Ppef2	T	A	5: 92,239,151		probably benign	Het
Prdm10	T	C	9: 31,340,407	I357T	possibly damaging	Het
Prrc2c	G	A	1: 162,698,185	T284I	unknown	Het
Psma3	T	C	12: 70,978,748	S13P	possibly damaging	Het
Ptch1	T	G	13: 63,524,959	E944A	probably benign	Het
Rpl6l	T	C	10: 111,126,365		noncoding transcript	Het
Tex11	A	G	X: 100,916,572	V522A	probably benign	Het
Thsd7b	A	G	1: 129,678,241	E573G	probably benign	Het
Tom1l1	A	G	11: 90,657,741	S259P	probably benign	Het
Vmn1r66	C	T	7: 10,274,321	A262T	possibly damaging	Het
Zc3h13	T	A	14: 75,330,661	D1131E	probably benign	Het
Zfp445	A	C	9: 122,854,726	D289E	probably benign	Het

Other mutations in Trpm8

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00963:Trpm8	APN	1	88379827	missense	possibly damaging	0.82
IGL01387:Trpm8	APN	1	88343287	missense	probably damaging	1.00
IGL01933:Trpm8	APN	1	88326405	missense	probably damaging	0.98
IGL02075:Trpm8	APN	1	88325488	missense	probably damaging	1.00
IGL02184:Trpm8	APN	1	88330694	critical splice acceptor site	probably null
IGL02342:Trpm8	APN	1	88328250	missense	possibly damaging	0.58
IGL02416:Trpm8	APN	1	88360716	missense	probably damaging	1.00
IGL02696:Trpm8	APN	1	88348051	missense	probably damaging	1.00
IGL02807:Trpm8	APN	1	88348108	missense	probably damaging	1.00
R0078:Trpm8	UTSW	1	88328148	splice site	probably benign
R1183:Trpm8	UTSW	1	88348091	missense	probably damaging	1.00
R1608:Trpm8	UTSW	1	88326432	missense	probably benign
R1713:Trpm8	UTSW	1	88365080	missense	probably damaging	1.00
R1724:Trpm8	UTSW	1	88350856	missense	possibly damaging	0.86
R1966:Trpm8	UTSW	1	88332748	splice site	probably null
R2089:Trpm8	UTSW	1	88343326	missense	probably damaging	0.99
R2091:Trpm8	UTSW	1	88343326	missense	probably damaging	0.99
R2091:Trpm8	UTSW	1	88343326	missense	probably damaging	0.99
R2384:Trpm8	UTSW	1	88359656	missense	probably benign	0.00
R2475:Trpm8	UTSW	1	88354449	missense	probably damaging	1.00
R3726:Trpm8	UTSW	1	88328196	missense	probably benign	0.00
R4063:Trpm8	UTSW	1	88362005	missense	probably damaging	1.00
R4678:Trpm8	UTSW	1	88337129	missense	probably benign	0.07
R4681:Trpm8	UTSW	1	88384705	missense	possibly damaging	0.63
R5031:Trpm8	UTSW	1	88348188	missense	probably benign	0.00
R5620:Trpm8	UTSW	1	88359651	critical splice acceptor site	probably null
R5644:Trpm8	UTSW	1	88359739	missense	possibly damaging	0.54
R5734:Trpm8	UTSW	1	88355280	missense	probably benign	0.01
R5839:Trpm8	UTSW	1	88325506	missense	possibly damaging	0.57
R5844:Trpm8	UTSW	1	88384711	makesense	probably null
R5845:Trpm8	UTSW	1	88328180	missense	probably benign	0.00
R5926:Trpm8	UTSW	1	88330747	missense	probably damaging	0.99
R5940:Trpm8	UTSW	1	88351415	nonsense	probably null
R6031:Trpm8	UTSW	1	88354469	missense	possibly damaging	0.95
R6031:Trpm8	UTSW	1	88354469	missense	possibly damaging	0.95
R6088:Trpm8	UTSW	1	88306678	start gained	probably benign
R6283:Trpm8	UTSW	1	88348332	missense	probably benign	0.09
R6299:Trpm8	UTSW	1	88354479	missense	probably damaging	1.00
R6367:Trpm8	UTSW	1	88359683	missense	probably damaging	1.00
R6526:Trpm8	UTSW	1	88361998	missense	probably damaging	0.98
R6682:Trpm8	UTSW	1	88326502	missense	probably damaging	0.96
R6751:Trpm8	UTSW	1	88384706	missense	possibly damaging	0.63
R7057:Trpm8	UTSW	1	88362080	missense	probably null	0.99
R7489:Trpm8	UTSW	1	88379759	missense	possibly damaging	0.85
R7520:Trpm8	UTSW	1	88343321	missense	probably benign	0.00
R7597:Trpm8	UTSW	1	88328196	missense	probably damaging	0.97
R7774:Trpm8	UTSW	1	88330841	missense	probably damaging	0.99
R7839:Trpm8	UTSW	1	88326454	missense	possibly damaging	0.83
R7948:Trpm8	UTSW	1	88374369	nonsense	probably null
R8176:Trpm8	UTSW	1	88365115	missense	probably benign	0.06
R8222:Trpm8	UTSW	1	88325668	splice site	probably null

Predicted Primers

PCR Primer
(F):5'- TGGAGAATGGCCTGAATCTGC -3'
(R):5'- TAGAGAAAATGCATAGCTCCCTTC -3'

Sequencing Primer
(F):5'- GCCTGAATCTGCAGAAGTTTC -3'
(R):5'- CTAGCTGCTTTATGGCAATGGGAAAG -3'

Posted On

2015-03-18