Mutagenetix > Incidental Mutation

Incidental Mutation 'R3745:Astn1'

271147

Institutional Source

Beutler Lab

Gene Symbol

Astn1

Ensembl Gene

ENSMUSG00000026587

Gene Name

astrotactin 1

Synonyms

MMRRC Submission

040731-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.089) question?

Stock #

R3745 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

158189843-158519351 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 158329630 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Alanine to Serine at position 162 (A162S)

Ref Sequence

ENSEMBL: ENSMUSP00000141518 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000046110] [ENSMUST00000170718] [ENSMUST00000193042] [ENSMUST00000194369] [ENSMUST00000195311]

AlphaFold

Q61137

Predicted Effect

probably damaging
Transcript: ENSMUST00000046110
AA Change: A162S

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000039711
Gene: ENSMUSG00000026587
AA Change: A162S

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
transmembrane domain	153	175	N/A	INTRINSIC
low complexity region	365	381	N/A	INTRINSIC
transmembrane domain	388	410	N/A	INTRINSIC
EGF	462	507	1.2e1	SMART
EGF	611	652	2.29e1	SMART
EGF_like	659	708	3.57e1	SMART
MACPF	811	999	1.11e-56	SMART
FN3	1030	1142	5.75e-2	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000093595

Predicted Effect

possibly damaging
Transcript: ENSMUST00000170718
AA Change: A162S

PolyPhen 2 Score 0.705 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000127428
Gene: ENSMUSG00000026587
AA Change: A162S

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
transmembrane domain	153	175	N/A	INTRINSIC
low complexity region	365	381	N/A	INTRINSIC
transmembrane domain	388	410	N/A	INTRINSIC
EGF	462	507	1.2e1	SMART
EGF	611	652	2.29e1	SMART
EGF_like	659	708	3.57e1	SMART
Blast:MACPF	811	835	3e-7	BLAST

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000192868

Predicted Effect

probably damaging
Transcript: ENSMUST00000193042
AA Change: A162S

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000142322
Gene: ENSMUSG00000026587
AA Change: A162S

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
transmembrane domain	153	175	N/A	INTRINSIC
low complexity region	365	381	N/A	INTRINSIC
transmembrane domain	388	410	N/A	INTRINSIC
EGF	462	507	1.2e1	SMART
EGF	611	652	2.29e1	SMART
EGF_like	659	708	3.57e1	SMART
MACPF	811	999	1.11e-56	SMART
FN3	1030	1142	5.75e-2	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000194369
AA Change: A162S

PolyPhen 2 Score 0.705 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000142017
Gene: ENSMUSG00000026587
AA Change: A162S

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
transmembrane domain	153	175	N/A	INTRINSIC
low complexity region	365	381	N/A	INTRINSIC
transmembrane domain	388	410	N/A	INTRINSIC
EGF	462	499	2e-2	SMART
EGF	603	644	1.1e-1	SMART
EGF_like	651	700	1.7e-1	SMART
Blast:MACPF	803	828	2e-7	BLAST

Predicted Effect

probably damaging
Transcript: ENSMUST00000195311
AA Change: A162S

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000141518
Gene: ENSMUSG00000026587
AA Change: A162S

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
transmembrane domain	153	175	N/A	INTRINSIC
low complexity region	365	381	N/A	INTRINSIC
transmembrane domain	388	410	N/A	INTRINSIC
EGF	462	499	2e-2	SMART
EGF	603	644	1.1e-1	SMART
EGF_like	651	700	1.7e-1	SMART
MACPF	803	991	6.2e-59	SMART
FN3	1022	1134	2.8e-4	SMART

Meta Mutation Damage Score

0.2318

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 94.8%

Validation Efficiency

98% (44/45)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Astrotactin is a neuronal adhesion molecule required for glial-guided migration of young postmitotic neuroblasts in cortical regions of developing brain, including cerebrum, hippocampus, cerebellum, and olfactory bulb (Fink et al., 1995).[supplied by OMIM, Jun 2009]
PHENOTYPE: Homozygous mutation of this gene results in reduced cerebellum size, abnormal Purkinje cell morphology, and reduced coordination performance on the Rotarod test. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 44 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700012B07Rik	G	T	11: 109,684,980 (GRCm39)	C172*	probably null	Het
Acot9	G	A	X: 154,054,941 (GRCm39)		probably benign	Het
Akap10	A	G	11: 61,806,131 (GRCm39)	V199A	probably benign	Het
Aox4	C	T	1: 58,285,029 (GRCm39)	H594Y	probably damaging	Het
Arhgap35	A	T	7: 16,297,647 (GRCm39)	Y473N	probably damaging	Het
Aspn	G	A	13: 49,720,036 (GRCm39)	E351K	probably damaging	Het
Atosa	T	C	9: 74,917,144 (GRCm39)	V581A	probably benign	Het
Auts2	A	G	5: 131,505,425 (GRCm39)		probably benign	Het
Cog6	A	T	3: 52,900,240 (GRCm39)	M507K	probably benign	Het
Crct1	C	A	3: 92,922,014 (GRCm39)		probably benign	Het
Cyp2d11	A	C	15: 82,276,056 (GRCm39)	I175S	probably benign	Het
Dclk1	A	G	3: 55,154,863 (GRCm39)	N98D	possibly damaging	Het
Erich5	T	A	15: 34,470,878 (GRCm39)	C36S	probably damaging	Het
F5	A	G	1: 164,014,348 (GRCm39)	I540V	possibly damaging	Het
Fam20a	A	T	11: 109,568,616 (GRCm39)	S303R	probably benign	Het
Fat3	G	A	9: 15,909,567 (GRCm39)	S2145F	probably damaging	Het
Gbp9	C	A	5: 105,253,724 (GRCm39)		probably benign	Het
Gm6408	G	T	5: 146,421,246 (GRCm39)	V292F	probably damaging	Het
Kmt2a	A	G	9: 44,742,637 (GRCm39)		probably benign	Het
Lrriq1	T	C	10: 103,006,717 (GRCm39)	D1136G	probably damaging	Het
Macrod2	C	A	2: 141,652,549 (GRCm39)	T204K	probably damaging	Het
Mlkl	A	G	8: 112,042,199 (GRCm39)		probably benign	Het
Msantd1	T	A	5: 35,080,811 (GRCm39)	V155E	possibly damaging	Het
Myo3b	A	G	2: 70,064,829 (GRCm39)		probably benign	Het
Nbn	T	A	4: 15,976,163 (GRCm39)	C375S	possibly damaging	Het
Nell2	A	C	15: 95,330,554 (GRCm39)	C231W	probably damaging	Het
Nipbl	A	G	15: 8,388,358 (GRCm39)	S421P	probably benign	Het
Npr3	A	T	15: 11,905,577 (GRCm39)	V50E	probably damaging	Het
Or4d10	A	G	19: 12,051,744 (GRCm39)	L84P	probably damaging	Het
Pclo	T	C	5: 14,728,435 (GRCm39)		probably benign	Het
Pkn3	A	G	2: 29,980,353 (GRCm39)	K785R	probably damaging	Het
Ppef2	T	A	5: 92,387,010 (GRCm39)		probably benign	Het
Prdm10	T	C	9: 31,251,703 (GRCm39)	I357T	possibly damaging	Het
Prrc2c	G	A	1: 162,525,754 (GRCm39)	T284I	unknown	Het
Psma3	T	C	12: 71,025,522 (GRCm39)	S13P	possibly damaging	Het
Ptch1	T	G	13: 63,672,773 (GRCm39)	E944A	probably benign	Het
Rpl6l	T	C	10: 110,962,226 (GRCm39)		noncoding transcript	Het
Tex11	A	G	X: 99,960,178 (GRCm39)	V522A	probably benign	Het
Thsd7b	A	G	1: 129,605,978 (GRCm39)	E573G	probably benign	Het
Tom1l1	A	G	11: 90,548,567 (GRCm39)	S259P	probably benign	Het
Trpm8	A	G	1: 88,276,049 (GRCm39)	E549G	probably benign	Het
Vmn1r66	C	T	7: 10,008,248 (GRCm39)	A262T	possibly damaging	Het
Zc3h13	T	A	14: 75,568,101 (GRCm39)	D1131E	probably benign	Het
Zfp445	A	C	9: 122,683,791 (GRCm39)	D289E	probably benign	Het

Other mutations in Astn1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00493:Astn1	APN	1	158,427,889 (GRCm39)	missense	possibly damaging	0.71
IGL01705:Astn1	APN	1	158,331,883 (GRCm39)	missense	probably damaging	1.00
IGL01790:Astn1	APN	1	158,407,897 (GRCm39)	missense	possibly damaging	0.70
IGL01962:Astn1	APN	1	158,496,201 (GRCm39)	missense	probably damaging	1.00
IGL02000:Astn1	APN	1	158,502,184 (GRCm39)	missense	probably damaging	1.00
IGL02119:Astn1	APN	1	158,338,724 (GRCm39)	intron	probably benign
IGL02168:Astn1	APN	1	158,436,911 (GRCm39)	missense	possibly damaging	0.93
IGL02239:Astn1	APN	1	158,491,700 (GRCm39)	critical splice donor site	probably null
IGL02271:Astn1	APN	1	158,338,520 (GRCm39)	splice site	probably benign
IGL02307:Astn1	APN	1	158,502,184 (GRCm39)	missense	probably damaging	1.00
IGL02504:Astn1	APN	1	158,329,978 (GRCm39)	missense	probably damaging	1.00
IGL02552:Astn1	APN	1	158,332,965 (GRCm39)	missense	possibly damaging	0.90
IGL02903:Astn1	APN	1	158,516,120 (GRCm39)	missense	probably damaging	0.99
IGL03003:Astn1	APN	1	158,439,965 (GRCm39)	missense	probably benign	0.00
IGL03007:Astn1	APN	1	158,496,193 (GRCm39)	splice site	probably benign
IGL03354:Astn1	APN	1	158,516,174 (GRCm39)	missense	probably damaging	1.00
PIT4366001:Astn1	UTSW	1	158,424,781 (GRCm39)	missense	probably benign	0.23
PIT4366001:Astn1	UTSW	1	158,424,779 (GRCm39)	missense	probably benign	0.20
R0024:Astn1	UTSW	1	158,511,785 (GRCm39)	missense	probably damaging	0.99
R0050:Astn1	UTSW	1	158,407,294 (GRCm39)	splice site	probably benign
R0099:Astn1	UTSW	1	158,329,721 (GRCm39)	missense	probably damaging	1.00
R0109:Astn1	UTSW	1	158,491,674 (GRCm39)	missense	possibly damaging	0.79
R0109:Astn1	UTSW	1	158,491,674 (GRCm39)	missense	possibly damaging	0.79
R0365:Astn1	UTSW	1	158,516,118 (GRCm39)	missense	probably damaging	1.00
R0416:Astn1	UTSW	1	158,337,461 (GRCm39)	missense	probably damaging	1.00
R0531:Astn1	UTSW	1	158,427,959 (GRCm39)	missense	probably damaging	0.99
R0735:Astn1	UTSW	1	158,299,959 (GRCm39)	missense	possibly damaging	0.53
R0763:Astn1	UTSW	1	158,337,460 (GRCm39)	missense	possibly damaging	0.93
R0899:Astn1	UTSW	1	158,338,679 (GRCm39)	nonsense	probably null
R1027:Astn1	UTSW	1	158,407,849 (GRCm39)	missense	probably damaging	1.00
R1160:Astn1	UTSW	1	158,427,935 (GRCm39)	missense	possibly damaging	0.83
R1474:Astn1	UTSW	1	158,329,923 (GRCm39)	missense	probably damaging	1.00
R1517:Astn1	UTSW	1	158,407,146 (GRCm39)	splice site	probably benign
R1701:Astn1	UTSW	1	158,331,877 (GRCm39)	missense	possibly damaging	0.54
R1764:Astn1	UTSW	1	158,331,821 (GRCm39)	missense	probably benign	0.35
R1860:Astn1	UTSW	1	158,429,515 (GRCm39)	missense	probably damaging	1.00
R1889:Astn1	UTSW	1	158,332,886 (GRCm39)	splice site	probably null
R1919:Astn1	UTSW	1	158,337,541 (GRCm39)	missense	probably damaging	1.00
R2001:Astn1	UTSW	1	158,348,091 (GRCm39)	missense	probably damaging	1.00
R2007:Astn1	UTSW	1	158,436,875 (GRCm39)	missense	probably damaging	0.97
R2038:Astn1	UTSW	1	158,484,690 (GRCm39)	missense	probably benign	0.29
R2044:Astn1	UTSW	1	158,428,072 (GRCm39)	missense	possibly damaging	0.53
R2084:Astn1	UTSW	1	158,299,978 (GRCm39)	missense	probably damaging	0.99
R2094:Astn1	UTSW	1	158,495,179 (GRCm39)	missense	probably benign	0.02
R2163:Astn1	UTSW	1	158,329,720 (GRCm39)	missense	probably damaging	0.99
R2211:Astn1	UTSW	1	158,484,876 (GRCm39)	missense	probably benign	0.40
R2268:Astn1	UTSW	1	158,329,669 (GRCm39)	missense	probably damaging	1.00
R2269:Astn1	UTSW	1	158,329,669 (GRCm39)	missense	probably damaging	1.00
R2425:Astn1	UTSW	1	158,407,236 (GRCm39)	missense	probably damaging	0.99
R2428:Astn1	UTSW	1	158,439,916 (GRCm39)	missense	possibly damaging	0.66
R2980:Astn1	UTSW	1	158,400,521 (GRCm39)	critical splice acceptor site	probably null
R3713:Astn1	UTSW	1	158,495,102 (GRCm39)	missense	possibly damaging	0.83
R3926:Astn1	UTSW	1	158,407,227 (GRCm39)	missense	possibly damaging	0.95
R4345:Astn1	UTSW	1	158,329,602 (GRCm39)	splice site	probably null
R4625:Astn1	UTSW	1	158,407,864 (GRCm39)	missense	probably damaging	1.00
R4627:Astn1	UTSW	1	158,329,821 (GRCm39)	missense	possibly damaging	0.55
R4970:Astn1	UTSW	1	158,484,763 (GRCm39)	missense	possibly damaging	0.88
R5112:Astn1	UTSW	1	158,484,763 (GRCm39)	missense	possibly damaging	0.88
R5257:Astn1	UTSW	1	158,440,102 (GRCm39)	missense	probably damaging	1.00
R5292:Astn1	UTSW	1	158,407,933 (GRCm39)	critical splice donor site	probably null
R5889:Astn1	UTSW	1	158,427,950 (GRCm39)	missense	possibly damaging	0.93
R5909:Astn1	UTSW	1	158,429,507 (GRCm39)	missense	probably damaging	1.00
R6020:Astn1	UTSW	1	158,337,563 (GRCm39)	missense	probably damaging	1.00
R6349:Astn1	UTSW	1	158,491,691 (GRCm39)	nonsense	probably null
R6481:Astn1	UTSW	1	158,440,032 (GRCm39)	missense	probably benign	0.29
R6736:Astn1	UTSW	1	158,338,718 (GRCm39)	critical splice donor site	probably null
R6833:Astn1	UTSW	1	158,491,692 (GRCm39)	missense	probably benign	0.40
R6834:Astn1	UTSW	1	158,491,692 (GRCm39)	missense	probably benign	0.40
R6860:Astn1	UTSW	1	158,440,042 (GRCm39)	missense	probably damaging	1.00
R6874:Astn1	UTSW	1	158,491,644 (GRCm39)	nonsense	probably null
R7062:Astn1	UTSW	1	158,516,081 (GRCm39)	critical splice acceptor site	probably null
R7133:Astn1	UTSW	1	158,400,557 (GRCm39)	missense	probably damaging	1.00
R7355:Astn1	UTSW	1	158,491,846 (GRCm39)	splice site	probably null
R7402:Astn1	UTSW	1	158,380,425 (GRCm39)	intron	probably benign
R7412:Astn1	UTSW	1	158,329,919 (GRCm39)	missense	probably damaging	0.98
R7487:Astn1	UTSW	1	158,438,352 (GRCm39)	splice site	probably null
R7537:Astn1	UTSW	1	158,495,208 (GRCm39)	splice site	probably null
R7537:Astn1	UTSW	1	158,332,956 (GRCm39)	missense	possibly damaging	0.84
R7635:Astn1	UTSW	1	158,495,105 (GRCm39)	nonsense	probably null
R7890:Astn1	UTSW	1	158,407,903 (GRCm39)	missense	probably damaging	1.00
R7894:Astn1	UTSW	1	158,429,508 (GRCm39)	missense	probably damaging	0.98
R7904:Astn1	UTSW	1	158,424,886 (GRCm39)	missense	probably benign	0.37
R8048:Astn1	UTSW	1	158,516,208 (GRCm39)	missense	probably benign	0.00
R8061:Astn1	UTSW	1	158,331,920 (GRCm39)	critical splice donor site	probably null
R8096:Astn1	UTSW	1	158,436,890 (GRCm39)	missense	probably damaging	1.00
R8327:Astn1	UTSW	1	158,436,850 (GRCm39)	missense	probably damaging	1.00
R8374:Astn1	UTSW	1	158,329,803 (GRCm39)	missense	probably damaging	1.00
R8400:Astn1	UTSW	1	158,484,670 (GRCm39)	missense	probably benign	0.09
R8983:Astn1	UTSW	1	158,491,700 (GRCm39)	critical splice donor site	probably null
R9013:Astn1	UTSW	1	158,348,070 (GRCm39)	missense	probably damaging	1.00
R9110:Astn1	UTSW	1	158,496,327 (GRCm39)	missense	probably benign	0.01
R9156:Astn1	UTSW	1	158,338,555 (GRCm39)	missense	probably damaging	0.99
R9355:Astn1	UTSW	1	158,511,721 (GRCm39)	missense	probably damaging	1.00
R9683:Astn1	UTSW	1	158,491,619 (GRCm39)	missense	possibly damaging	0.93
Z1088:Astn1	UTSW	1	158,511,666 (GRCm39)	nonsense	probably null
Z1088:Astn1	UTSW	1	158,424,776 (GRCm39)	missense	possibly damaging	0.91
Z1088:Astn1	UTSW	1	158,300,067 (GRCm39)	missense	possibly damaging	0.93

Predicted Primers

PCR Primer
(F):5'- GCACCAATACCTGCAGAGTG -3'
(R):5'- TCAGAGTGCCACTGGAGTTG -3'

Sequencing Primer
(F):5'- AATACCTGCAGAGTGTCCCTTAG -3'
(R):5'- AGTTGTGGCCCTGCACAC -3'

Posted On

2015-03-18