Mutagenetix > Incidental Mutation

Incidental Mutation 'R3745:Pkn3'

271150

Institutional Source

Beutler Lab

Gene Symbol

Pkn3

Ensembl Gene

ENSMUSG00000026785

Gene Name

protein kinase N3

Synonyms

MMRRC Submission

040731-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R3745 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

30077684-30091022 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 30090341 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Lysine to Arginine at position 785 (K785R)

Ref Sequence

ENSEMBL: ENSMUSP00000041025 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000045246] [ENSMUST00000081838] [ENSMUST00000102865]

AlphaFold

Q8K045

Predicted Effect

probably damaging
Transcript: ENSMUST00000045246
AA Change: K785R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000041025
Gene: ENSMUSG00000026785
AA Change: K785R

Domain	Start	End	E-Value	Type
Hr1	15	78	3.45e-17	SMART
Hr1	98	166	6.19e-19	SMART
Hr1	171	239	3.32e-19	SMART
low complexity region	528	537	N/A	INTRINSIC
S_TKc	548	807	2.52e-93	SMART
S_TK_X	808	872	9.58e-16	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000081838

SMART Domains

Protein: ENSMUSP00000080521
Gene: ENSMUSG00000015335

Domain	Start	End	E-Value	Type
transmembrane domain	58	80	N/A	INTRINSIC
low complexity region	89	100	N/A	INTRINSIC
Pfam:zf-DHHC	106	232	1.9e-30	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000102865

SMART Domains

Protein: ENSMUSP00000099929
Gene: ENSMUSG00000015335

Domain	Start	End	E-Value	Type
transmembrane domain	7	29	N/A	INTRINSIC
Pfam:zf-DHHC	58	218	1.1e-38	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000134591

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000137001

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000137240

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000148650

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000148717

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000156197

Meta Mutation Damage Score

0.4479

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 94.8%

Validation Efficiency

98% (44/45)

MGI Phenotype

PHENOTYPE: Mice homozygous for a null mutation are viable, fertile and healthy. Mice with conditional loss of this gene and Pten in hematopoietic cells show a delay in leukemia development. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 44 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700012B07Rik	G	T	11: 109,794,154	C172*	probably null	Het
Acot9	G	A	X: 155,271,945		probably benign	Het
Akap10	A	G	11: 61,915,305	V199A	probably benign	Het
Aox4	C	T	1: 58,245,870	H594Y	probably damaging	Het
Arhgap35	A	T	7: 16,563,722	Y473N	probably damaging	Het
Aspn	G	A	13: 49,566,560	E351K	probably damaging	Het
Astn1	G	T	1: 158,502,060	A162S	probably damaging	Het
Auts2	A	G	5: 131,476,587		probably benign	Het
Cog6	A	T	3: 52,992,819	M507K	probably benign	Het
Crct1	C	A	3: 93,014,707		probably benign	Het
Cyp2d11	A	C	15: 82,391,855	I175S	probably benign	Het
Dclk1	A	G	3: 55,247,442	N98D	possibly damaging	Het
Erich5	T	A	15: 34,470,732	C36S	probably damaging	Het
F5	A	G	1: 164,186,779	I540V	possibly damaging	Het
Fam20a	A	T	11: 109,677,790	S303R	probably benign	Het
Fam214a	T	C	9: 75,009,862	V581A	probably benign	Het
Fat3	G	A	9: 15,998,271	S2145F	probably damaging	Het
Gbp9	C	A	5: 105,105,858		probably benign	Het
Gm6408	G	T	5: 146,484,436	V292F	probably damaging	Het
Kmt2a	A	G	9: 44,831,340		probably benign	Het
Lrriq1	T	C	10: 103,170,856	D1136G	probably damaging	Het
Macrod2	C	A	2: 141,810,629	T204K	probably damaging	Het
Mlkl	A	G	8: 111,315,567		probably benign	Het
Msantd1	T	A	5: 34,923,467	V155E	possibly damaging	Het
Myo3b	A	G	2: 70,234,485		probably benign	Het
Nbn	T	A	4: 15,976,163	C375S	possibly damaging	Het
Nell2	A	C	15: 95,432,673	C231W	probably damaging	Het
Nipbl	A	G	15: 8,358,874	S421P	probably benign	Het
Npr3	A	T	15: 11,905,491	V50E	probably damaging	Het
Olfr1425	A	G	19: 12,074,380	L84P	probably damaging	Het
Pclo	T	C	5: 14,678,421		probably benign	Het
Ppef2	T	A	5: 92,239,151		probably benign	Het
Prdm10	T	C	9: 31,340,407	I357T	possibly damaging	Het
Prrc2c	G	A	1: 162,698,185	T284I	unknown	Het
Psma3	T	C	12: 70,978,748	S13P	possibly damaging	Het
Ptch1	T	G	13: 63,524,959	E944A	probably benign	Het
Rpl6l	T	C	10: 111,126,365		noncoding transcript	Het
Tex11	A	G	X: 100,916,572	V522A	probably benign	Het
Thsd7b	A	G	1: 129,678,241	E573G	probably benign	Het
Tom1l1	A	G	11: 90,657,741	S259P	probably benign	Het
Trpm8	A	G	1: 88,348,327	E549G	probably benign	Het
Vmn1r66	C	T	7: 10,274,321	A262T	possibly damaging	Het
Zc3h13	T	A	14: 75,330,661	D1131E	probably benign	Het
Zfp445	A	C	9: 122,854,726	D289E	probably benign	Het

Other mutations in Pkn3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00422:Pkn3	APN	2	30081104	missense	probably damaging	0.97
IGL00781:Pkn3	APN	2	30083390	unclassified	probably benign
IGL00815:Pkn3	APN	2	30081200	missense	possibly damaging	0.88
IGL01576:Pkn3	APN	2	30087042	missense	probably damaging	1.00
IGL01897:Pkn3	APN	2	30082812	unclassified	probably benign
IGL02513:Pkn3	APN	2	30083137	missense	probably damaging	0.98
IGL02552:Pkn3	APN	2	30080867	missense	probably damaging	1.00
IGL02622:Pkn3	APN	2	30083146	missense	probably benign	0.28
IGL02689:Pkn3	APN	2	30080846	missense	probably damaging	1.00
IGL02996:Pkn3	APN	2	30080615	missense	probably benign	0.39
IGL03106:Pkn3	APN	2	30085245	missense	probably damaging	0.96
Enflamme	UTSW	2	30083037	unclassified	probably benign
Wrath	UTSW	2	30088584	critical splice donor site	probably null
PIT4151001:Pkn3	UTSW	2	30090527	missense	probably damaging	1.00
R0279:Pkn3	UTSW	2	30083297	missense	probably benign	0.16
R0370:Pkn3	UTSW	2	30087172	missense	probably damaging	1.00
R0491:Pkn3	UTSW	2	30089877	missense	probably damaging	1.00
R0600:Pkn3	UTSW	2	30081134	missense	probably benign	0.06
R1418:Pkn3	UTSW	2	30083047	missense	probably damaging	1.00
R1510:Pkn3	UTSW	2	30079764	critical splice donor site	probably null
R1535:Pkn3	UTSW	2	30087053	missense	probably benign
R1540:Pkn3	UTSW	2	30084691	missense	probably damaging	1.00
R1808:Pkn3	UTSW	2	30079651	missense	probably damaging	1.00
R1884:Pkn3	UTSW	2	30082828	missense	probably damaging	1.00
R1995:Pkn3	UTSW	2	30089977	missense	probably damaging	1.00
R4119:Pkn3	UTSW	2	30083037	unclassified	probably benign
R4258:Pkn3	UTSW	2	30088560	missense	probably damaging	0.99
R4665:Pkn3	UTSW	2	30085457	unclassified	probably benign
R4772:Pkn3	UTSW	2	30084680	splice site	probably null
R4808:Pkn3	UTSW	2	30090081	missense	probably damaging	1.00
R5038:Pkn3	UTSW	2	30085281	critical splice donor site	probably null
R5388:Pkn3	UTSW	2	30081074	missense	probably damaging	0.99
R5488:Pkn3	UTSW	2	30088584	critical splice donor site	probably null
R5611:Pkn3	UTSW	2	30079661	missense	probably damaging	1.00
R6001:Pkn3	UTSW	2	30088584	critical splice donor site	probably null
R6277:Pkn3	UTSW	2	30082945	missense	possibly damaging	0.93
R6562:Pkn3	UTSW	2	30080687	critical splice donor site	probably null
R6724:Pkn3	UTSW	2	30090550	missense	possibly damaging	0.94
R7061:Pkn3	UTSW	2	30083536	splice site	probably null
R7128:Pkn3	UTSW	2	30083315	missense	probably damaging	1.00
R7249:Pkn3	UTSW	2	30084761	missense	probably benign	0.00
R7475:Pkn3	UTSW	2	30087110	missense	probably benign	0.01
R7746:Pkn3	UTSW	2	30090584	missense	probably benign	0.00
R7747:Pkn3	UTSW	2	30090584	missense	probably benign	0.00
R7783:Pkn3	UTSW	2	30079622	missense	probably damaging	1.00
R8401:Pkn3	UTSW	2	30080059	missense	probably benign	0.00
R8425:Pkn3	UTSW	2	30086501	critical splice donor site	probably null
R8535:Pkn3	UTSW	2	30079924	critical splice acceptor site	probably null
R8720:Pkn3	UTSW	2	30085184	missense	probably benign	0.01
R8743:Pkn3	UTSW	2	30083306	missense	probably benign	0.00
R9415:Pkn3	UTSW	2	30078320	missense	probably benign	0.20
R9437:Pkn3	UTSW	2	30083255	missense	possibly damaging	0.93
R9583:Pkn3	UTSW	2	30086711	missense	probably null	0.99
R9800:Pkn3	UTSW	2	30083278	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- AGTGCTGATGTCCCATGTCC -3'
(R):5'- TGGTGGTCTGAACAAGGTACAG -3'

Sequencing Primer
(F):5'- TGCAAGGGCTCGAACTCATTC -3'
(R):5'- GTCTGAACAAGGTACAGGAATATAAG -3'

Posted On

2015-03-18