Incidental Mutation 'R3745:Cog6'
ID 271153
Institutional Source Beutler Lab
Gene Symbol Cog6
Ensembl Gene ENSMUSG00000027742
Gene Name component of oligomeric golgi complex 6
Synonyms
MMRRC Submission 040731-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R3745 (G1)
Quality Score 225
Status Validated
Chromosome 3
Chromosomal Location 52889544-52924644 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 52900240 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Lysine at position 507 (M507K)
Ref Sequence ENSEMBL: ENSMUSP00000048603 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036665] [ENSMUST00000193432] [ENSMUST00000195183]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000036665
AA Change: M507K

PolyPhen 2 Score 0.046 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000048603
Gene: ENSMUSG00000027742
AA Change: M507K

DomainStartEndE-ValueType
low complexity region 13 26 N/A INTRINSIC
COG6 55 656 N/A SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192788
Predicted Effect probably benign
Transcript: ENSMUST00000193432
AA Change: M507K

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000141339
Gene: ENSMUSG00000027742
AA Change: M507K

DomainStartEndE-ValueType
low complexity region 13 26 N/A INTRINSIC
COG6 55 625 5e-289 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194779
Predicted Effect probably benign
Transcript: ENSMUST00000195183
SMART Domains Protein: ENSMUSP00000141733
Gene: ENSMUSG00000027742

DomainStartEndE-ValueType
low complexity region 13 26 N/A INTRINSIC
Pfam:COG6 39 174 5.5e-32 PFAM
Meta Mutation Damage Score 0.1714 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 98% (44/45)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of the conserved oligomeric Golgi complex that is required for maintaining normal structure and activity of the Golgi apparatus. The encoded protein is organized with conserved oligomeric Golgi complex components 5, 7 and 8 into a sub-complex referred to as lobe B. Alternative splicing results in multiple transcript variants.[provided by RefSeq, Feb 2009]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012B07Rik G T 11: 109,684,980 (GRCm39) C172* probably null Het
Acot9 G A X: 154,054,941 (GRCm39) probably benign Het
Akap10 A G 11: 61,806,131 (GRCm39) V199A probably benign Het
Aox4 C T 1: 58,285,029 (GRCm39) H594Y probably damaging Het
Arhgap35 A T 7: 16,297,647 (GRCm39) Y473N probably damaging Het
Aspn G A 13: 49,720,036 (GRCm39) E351K probably damaging Het
Astn1 G T 1: 158,329,630 (GRCm39) A162S probably damaging Het
Atosa T C 9: 74,917,144 (GRCm39) V581A probably benign Het
Auts2 A G 5: 131,505,425 (GRCm39) probably benign Het
Crct1 C A 3: 92,922,014 (GRCm39) probably benign Het
Cyp2d11 A C 15: 82,276,056 (GRCm39) I175S probably benign Het
Dclk1 A G 3: 55,154,863 (GRCm39) N98D possibly damaging Het
Erich5 T A 15: 34,470,878 (GRCm39) C36S probably damaging Het
F5 A G 1: 164,014,348 (GRCm39) I540V possibly damaging Het
Fam20a A T 11: 109,568,616 (GRCm39) S303R probably benign Het
Fat3 G A 9: 15,909,567 (GRCm39) S2145F probably damaging Het
Gbp9 C A 5: 105,253,724 (GRCm39) probably benign Het
Gm6408 G T 5: 146,421,246 (GRCm39) V292F probably damaging Het
Kmt2a A G 9: 44,742,637 (GRCm39) probably benign Het
Lrriq1 T C 10: 103,006,717 (GRCm39) D1136G probably damaging Het
Macrod2 C A 2: 141,652,549 (GRCm39) T204K probably damaging Het
Mlkl A G 8: 112,042,199 (GRCm39) probably benign Het
Msantd1 T A 5: 35,080,811 (GRCm39) V155E possibly damaging Het
Myo3b A G 2: 70,064,829 (GRCm39) probably benign Het
Nbn T A 4: 15,976,163 (GRCm39) C375S possibly damaging Het
Nell2 A C 15: 95,330,554 (GRCm39) C231W probably damaging Het
Nipbl A G 15: 8,388,358 (GRCm39) S421P probably benign Het
Npr3 A T 15: 11,905,577 (GRCm39) V50E probably damaging Het
Or4d10 A G 19: 12,051,744 (GRCm39) L84P probably damaging Het
Pclo T C 5: 14,728,435 (GRCm39) probably benign Het
Pkn3 A G 2: 29,980,353 (GRCm39) K785R probably damaging Het
Ppef2 T A 5: 92,387,010 (GRCm39) probably benign Het
Prdm10 T C 9: 31,251,703 (GRCm39) I357T possibly damaging Het
Prrc2c G A 1: 162,525,754 (GRCm39) T284I unknown Het
Psma3 T C 12: 71,025,522 (GRCm39) S13P possibly damaging Het
Ptch1 T G 13: 63,672,773 (GRCm39) E944A probably benign Het
Rpl6l T C 10: 110,962,226 (GRCm39) noncoding transcript Het
Tex11 A G X: 99,960,178 (GRCm39) V522A probably benign Het
Thsd7b A G 1: 129,605,978 (GRCm39) E573G probably benign Het
Tom1l1 A G 11: 90,548,567 (GRCm39) S259P probably benign Het
Trpm8 A G 1: 88,276,049 (GRCm39) E549G probably benign Het
Vmn1r66 C T 7: 10,008,248 (GRCm39) A262T possibly damaging Het
Zc3h13 T A 14: 75,568,101 (GRCm39) D1131E probably benign Het
Zfp445 A C 9: 122,683,791 (GRCm39) D289E probably benign Het
Other mutations in Cog6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01922:Cog6 APN 3 52,893,846 (GRCm39) missense probably benign 0.03
IGL01946:Cog6 APN 3 52,909,825 (GRCm39) intron probably benign
IGL02122:Cog6 APN 3 52,905,763 (GRCm39) missense probably benign 0.04
IGL02589:Cog6 APN 3 52,914,691 (GRCm39) missense probably damaging 1.00
IGL02819:Cog6 APN 3 52,916,966 (GRCm39) missense probably damaging 0.98
R0045:Cog6 UTSW 3 52,900,171 (GRCm39) splice site probably null
R0045:Cog6 UTSW 3 52,900,171 (GRCm39) splice site probably null
R0086:Cog6 UTSW 3 52,900,991 (GRCm39) missense probably damaging 0.98
R0545:Cog6 UTSW 3 52,903,496 (GRCm39) missense probably damaging 1.00
R0707:Cog6 UTSW 3 52,921,283 (GRCm39) missense possibly damaging 0.71
R0718:Cog6 UTSW 3 52,918,050 (GRCm39) missense probably benign 0.35
R1169:Cog6 UTSW 3 52,921,265 (GRCm39) missense probably benign 0.30
R1451:Cog6 UTSW 3 52,916,534 (GRCm39) missense possibly damaging 0.78
R1891:Cog6 UTSW 3 52,890,601 (GRCm39) missense probably benign
R2249:Cog6 UTSW 3 52,907,900 (GRCm39) critical splice donor site probably null
R2264:Cog6 UTSW 3 52,900,332 (GRCm39) nonsense probably null
R4027:Cog6 UTSW 3 52,909,950 (GRCm39) missense possibly damaging 0.95
R4230:Cog6 UTSW 3 52,900,229 (GRCm39) missense probably benign 0.13
R4400:Cog6 UTSW 3 52,920,362 (GRCm39) missense probably benign 0.11
R4551:Cog6 UTSW 3 52,905,741 (GRCm39) missense probably damaging 1.00
R4866:Cog6 UTSW 3 52,918,019 (GRCm39) missense probably benign 0.10
R5326:Cog6 UTSW 3 52,921,237 (GRCm39) missense probably null 0.12
R6169:Cog6 UTSW 3 52,914,722 (GRCm39) missense probably benign 0.03
R6273:Cog6 UTSW 3 52,903,473 (GRCm39) missense probably damaging 1.00
R7169:Cog6 UTSW 3 52,897,387 (GRCm39) missense possibly damaging 0.94
R7199:Cog6 UTSW 3 52,890,610 (GRCm39) missense probably benign 0.21
R7243:Cog6 UTSW 3 52,909,736 (GRCm39) missense probably damaging 1.00
R7299:Cog6 UTSW 3 52,909,928 (GRCm39) missense probably benign 0.01
R8254:Cog6 UTSW 3 52,900,938 (GRCm39) missense probably benign
R8687:Cog6 UTSW 3 52,892,338 (GRCm39) missense probably benign
R8759:Cog6 UTSW 3 52,897,465 (GRCm39) missense probably damaging 1.00
R8827:Cog6 UTSW 3 52,890,535 (GRCm39) missense probably benign
R9539:Cog6 UTSW 3 52,914,722 (GRCm39) missense probably benign 0.03
R9688:Cog6 UTSW 3 52,916,528 (GRCm39) missense probably benign 0.03
R9729:Cog6 UTSW 3 52,900,907 (GRCm39) missense probably damaging 0.98
Z1177:Cog6 UTSW 3 52,921,285 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GCATGCATGTGTTTACATCCTC -3'
(R):5'- GTTAGCTGGCTATCCTCAGTTAG -3'

Sequencing Primer
(F):5'- CATCCTCTGGATAGACTACCTTAAGG -3'
(R):5'- GGCTATCCTCAGTTAGTTTTGC -3'
Posted On 2015-03-18