Incidental Mutation 'R3745:Nbn'
ID271156
Institutional Source Beutler Lab
Gene Symbol Nbn
Ensembl Gene ENSMUSG00000028224
Gene Namenibrin
SynonymsNbs1
MMRRC Submission 040731-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3745 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location15957925-15992589 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 15976163 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 375 (C375S)
Ref Sequence ENSEMBL: ENSMUSP00000120829 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029879] [ENSMUST00000149069]
Predicted Effect probably benign
Transcript: ENSMUST00000029879
AA Change: C375S

PolyPhen 2 Score 0.323 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000029879
Gene: ENSMUSG00000028224
AA Change: C375S

DomainStartEndE-ValueType
low complexity region 4 13 N/A INTRINSIC
FHA 23 83 2.27e-4 SMART
BRCT 103 184 6.37e0 SMART
Pfam:NIBRIN_BRCT_II 216 325 2.2e-34 PFAM
low complexity region 557 565 N/A INTRINSIC
Nbs1_C 680 744 2.14e-34 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000149069
AA Change: C375S

PolyPhen 2 Score 0.669 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000120829
Gene: ENSMUSG00000028224
AA Change: C375S

DomainStartEndE-ValueType
low complexity region 4 13 N/A INTRINSIC
FHA 23 83 2.27e-4 SMART
BRCT 103 184 6.37e0 SMART
PDB:2K2W|A 217 326 3e-32 PDB
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 98% (44/45)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Mutations in this gene are associated with Nijmegen breakage syndrome, an autosomal recessive chromosomal instability syndrome characterized by microcephaly, growth retardation, immunodeficiency, and cancer predisposition. The encoded protein is a member of the MRE11/RAD50 double-strand break repair complex which consists of 5 proteins. This gene product is thought to be involved in DNA double-strand break repair and DNA damage-induced checkpoint activation. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous targeted mutations exhibit phenotypes ranging from impaired extraembryonic tissue growth and early embryonic death to growth retardation, lymphoid defects, lymphoma susceptibility, and failure of oogenesis. Null heterozygotes are cancer prone. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012B07Rik G T 11: 109,794,154 C172* probably null Het
Acot9 G A X: 155,271,945 probably benign Het
Akap10 A G 11: 61,915,305 V199A probably benign Het
Aox4 C T 1: 58,245,870 H594Y probably damaging Het
Arhgap35 A T 7: 16,563,722 Y473N probably damaging Het
Aspn G A 13: 49,566,560 E351K probably damaging Het
Astn1 G T 1: 158,502,060 A162S probably damaging Het
Auts2 A G 5: 131,476,587 probably benign Het
Cog6 A T 3: 52,992,819 M507K probably benign Het
Crct1 C A 3: 93,014,707 probably benign Het
Cyp2d11 A C 15: 82,391,855 I175S probably benign Het
Dclk1 A G 3: 55,247,442 N98D possibly damaging Het
Erich5 T A 15: 34,470,732 C36S probably damaging Het
F5 A G 1: 164,186,779 I540V possibly damaging Het
Fam20a A T 11: 109,677,790 S303R probably benign Het
Fam214a T C 9: 75,009,862 V581A probably benign Het
Fat3 G A 9: 15,998,271 S2145F probably damaging Het
Gbp9 C A 5: 105,105,858 probably benign Het
Gm6408 G T 5: 146,484,436 V292F probably damaging Het
Kmt2a A G 9: 44,831,340 probably benign Het
Lrriq1 T C 10: 103,170,856 D1136G probably damaging Het
Macrod2 C A 2: 141,810,629 T204K probably damaging Het
Mlkl A G 8: 111,315,567 probably benign Het
Msantd1 T A 5: 34,923,467 V155E possibly damaging Het
Myo3b A G 2: 70,234,485 probably benign Het
Nell2 A C 15: 95,432,673 C231W probably damaging Het
Nipbl A G 15: 8,358,874 S421P probably benign Het
Npr3 A T 15: 11,905,491 V50E probably damaging Het
Olfr1425 A G 19: 12,074,380 L84P probably damaging Het
Pclo T C 5: 14,678,421 probably benign Het
Pkn3 A G 2: 30,090,341 K785R probably damaging Het
Ppef2 T A 5: 92,239,151 probably benign Het
Prdm10 T C 9: 31,340,407 I357T possibly damaging Het
Prrc2c G A 1: 162,698,185 T284I unknown Het
Psma3 T C 12: 70,978,748 S13P possibly damaging Het
Ptch1 T G 13: 63,524,959 E944A probably benign Het
Rpl6l T C 10: 111,126,365 noncoding transcript Het
Tex11 A G X: 100,916,572 V522A probably benign Het
Thsd7b A G 1: 129,678,241 E573G probably benign Het
Tom1l1 A G 11: 90,657,741 S259P probably benign Het
Trpm8 A G 1: 88,348,327 E549G probably benign Het
Vmn1r66 C T 7: 10,274,321 A262T possibly damaging Het
Zc3h13 T A 14: 75,330,661 D1131E probably benign Het
Zfp445 A C 9: 122,854,726 D289E probably benign Het
Other mutations in Nbn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00833:Nbn APN 4 15964320 missense probably benign 0.01
IGL00921:Nbn APN 4 15963833 missense possibly damaging 0.85
IGL01621:Nbn APN 4 15965221 missense probably benign 0.45
IGL02372:Nbn APN 4 15986613 missense probably benign 0.00
IGL03392:Nbn APN 4 15962362 missense probably damaging 1.00
R0238:Nbn UTSW 4 15986672 splice site probably benign
R0244:Nbn UTSW 4 15979353 missense probably benign 0.00
R0432:Nbn UTSW 4 15983951 unclassified probably benign
R0946:Nbn UTSW 4 15970719 critical splice acceptor site probably null
R1076:Nbn UTSW 4 15970719 critical splice acceptor site probably null
R1563:Nbn UTSW 4 15981668 missense possibly damaging 0.77
R1579:Nbn UTSW 4 15964289 missense probably damaging 0.99
R1660:Nbn UTSW 4 15971771 missense probably benign 0.06
R1663:Nbn UTSW 4 15970903 missense probably benign 0.13
R2005:Nbn UTSW 4 15979351 missense probably benign 0.01
R2010:Nbn UTSW 4 15969393 missense probably damaging 1.00
R2077:Nbn UTSW 4 15979389 missense probably damaging 1.00
R2228:Nbn UTSW 4 15970904 missense probably benign 0.01
R2229:Nbn UTSW 4 15970904 missense probably benign 0.01
R2356:Nbn UTSW 4 15970863 missense probably damaging 0.96
R2869:Nbn UTSW 4 15963810 missense probably damaging 1.00
R2869:Nbn UTSW 4 15963810 missense probably damaging 1.00
R3508:Nbn UTSW 4 15962387 missense probably damaging 1.00
R3753:Nbn UTSW 4 15964269 missense probably damaging 0.98
R4756:Nbn UTSW 4 15981470 missense probably benign 0.06
R5042:Nbn UTSW 4 15981446 missense probably benign 0.10
R5177:Nbn UTSW 4 15965132 critical splice acceptor site probably null
R5229:Nbn UTSW 4 15963893 missense probably damaging 0.98
R5368:Nbn UTSW 4 15969391 missense probably damaging 1.00
R5431:Nbn UTSW 4 15986593 missense probably benign
R6025:Nbn UTSW 4 15981347 missense probably damaging 0.97
R6375:Nbn UTSW 4 15979327 missense probably benign
R6543:Nbn UTSW 4 15986605 missense probably benign 0.39
R6655:Nbn UTSW 4 15981696 missense probably damaging 0.98
R6965:Nbn UTSW 4 15970863 missense probably benign 0.25
R7090:Nbn UTSW 4 15981350 missense probably benign 0.06
R7159:Nbn UTSW 4 15983677 intron probably null
R7241:Nbn UTSW 4 15991190 missense probably benign 0.00
R7267:Nbn UTSW 4 15979320 missense probably benign 0.00
R7597:Nbn UTSW 4 15963911 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCCCAAAACAGCTTGAGGT -3'
(R):5'- GGGTCAAGCATCTCTAACAAAGT -3'

Sequencing Primer
(F):5'- TAAAGACAACGACTCCAGG -3'
(R):5'- TATTACACAGACTGAGCGGATTGC -3'
Posted On2015-03-18