Incidental Mutation 'R3745:Nbn'
ID 271156
Institutional Source Beutler Lab
Gene Symbol Nbn
Ensembl Gene ENSMUSG00000028224
Gene Name nibrin
Synonyms Nbs1
MMRRC Submission 040731-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R3745 (G1)
Quality Score 225
Status Validated
Chromosome 4
Chromosomal Location 15957925-15992589 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 15976163 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Cysteine to Serine at position 375 (C375S)
Ref Sequence ENSEMBL: ENSMUSP00000120829 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029879] [ENSMUST00000149069]
AlphaFold Q9R207
Predicted Effect probably benign
Transcript: ENSMUST00000029879
AA Change: C375S

PolyPhen 2 Score 0.323 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000029879
Gene: ENSMUSG00000028224
AA Change: C375S

DomainStartEndE-ValueType
low complexity region 4 13 N/A INTRINSIC
FHA 23 83 2.27e-4 SMART
BRCT 103 184 6.37e0 SMART
Pfam:NIBRIN_BRCT_II 216 325 2.2e-34 PFAM
low complexity region 557 565 N/A INTRINSIC
Nbs1_C 680 744 2.14e-34 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000149069
AA Change: C375S

PolyPhen 2 Score 0.669 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000120829
Gene: ENSMUSG00000028224
AA Change: C375S

DomainStartEndE-ValueType
low complexity region 4 13 N/A INTRINSIC
FHA 23 83 2.27e-4 SMART
BRCT 103 184 6.37e0 SMART
PDB:2K2W|A 217 326 3e-32 PDB
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 98% (44/45)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Mutations in this gene are associated with Nijmegen breakage syndrome, an autosomal recessive chromosomal instability syndrome characterized by microcephaly, growth retardation, immunodeficiency, and cancer predisposition. The encoded protein is a member of the MRE11/RAD50 double-strand break repair complex which consists of 5 proteins. This gene product is thought to be involved in DNA double-strand break repair and DNA damage-induced checkpoint activation. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous targeted mutations exhibit phenotypes ranging from impaired extraembryonic tissue growth and early embryonic death to growth retardation, lymphoid defects, lymphoma susceptibility, and failure of oogenesis. Null heterozygotes are cancer prone. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012B07Rik G T 11: 109,684,980 (GRCm39) C172* probably null Het
Acot9 G A X: 154,054,941 (GRCm39) probably benign Het
Akap10 A G 11: 61,806,131 (GRCm39) V199A probably benign Het
Aox4 C T 1: 58,285,029 (GRCm39) H594Y probably damaging Het
Arhgap35 A T 7: 16,297,647 (GRCm39) Y473N probably damaging Het
Aspn G A 13: 49,720,036 (GRCm39) E351K probably damaging Het
Astn1 G T 1: 158,329,630 (GRCm39) A162S probably damaging Het
Atosa T C 9: 74,917,144 (GRCm39) V581A probably benign Het
Auts2 A G 5: 131,505,425 (GRCm39) probably benign Het
Cog6 A T 3: 52,900,240 (GRCm39) M507K probably benign Het
Crct1 C A 3: 92,922,014 (GRCm39) probably benign Het
Cyp2d11 A C 15: 82,276,056 (GRCm39) I175S probably benign Het
Dclk1 A G 3: 55,154,863 (GRCm39) N98D possibly damaging Het
Erich5 T A 15: 34,470,878 (GRCm39) C36S probably damaging Het
F5 A G 1: 164,014,348 (GRCm39) I540V possibly damaging Het
Fam20a A T 11: 109,568,616 (GRCm39) S303R probably benign Het
Fat3 G A 9: 15,909,567 (GRCm39) S2145F probably damaging Het
Gbp9 C A 5: 105,253,724 (GRCm39) probably benign Het
Gm6408 G T 5: 146,421,246 (GRCm39) V292F probably damaging Het
Kmt2a A G 9: 44,742,637 (GRCm39) probably benign Het
Lrriq1 T C 10: 103,006,717 (GRCm39) D1136G probably damaging Het
Macrod2 C A 2: 141,652,549 (GRCm39) T204K probably damaging Het
Mlkl A G 8: 112,042,199 (GRCm39) probably benign Het
Msantd1 T A 5: 35,080,811 (GRCm39) V155E possibly damaging Het
Myo3b A G 2: 70,064,829 (GRCm39) probably benign Het
Nell2 A C 15: 95,330,554 (GRCm39) C231W probably damaging Het
Nipbl A G 15: 8,388,358 (GRCm39) S421P probably benign Het
Npr3 A T 15: 11,905,577 (GRCm39) V50E probably damaging Het
Or4d10 A G 19: 12,051,744 (GRCm39) L84P probably damaging Het
Pclo T C 5: 14,728,435 (GRCm39) probably benign Het
Pkn3 A G 2: 29,980,353 (GRCm39) K785R probably damaging Het
Ppef2 T A 5: 92,387,010 (GRCm39) probably benign Het
Prdm10 T C 9: 31,251,703 (GRCm39) I357T possibly damaging Het
Prrc2c G A 1: 162,525,754 (GRCm39) T284I unknown Het
Psma3 T C 12: 71,025,522 (GRCm39) S13P possibly damaging Het
Ptch1 T G 13: 63,672,773 (GRCm39) E944A probably benign Het
Rpl6l T C 10: 110,962,226 (GRCm39) noncoding transcript Het
Tex11 A G X: 99,960,178 (GRCm39) V522A probably benign Het
Thsd7b A G 1: 129,605,978 (GRCm39) E573G probably benign Het
Tom1l1 A G 11: 90,548,567 (GRCm39) S259P probably benign Het
Trpm8 A G 1: 88,276,049 (GRCm39) E549G probably benign Het
Vmn1r66 C T 7: 10,008,248 (GRCm39) A262T possibly damaging Het
Zc3h13 T A 14: 75,568,101 (GRCm39) D1131E probably benign Het
Zfp445 A C 9: 122,683,791 (GRCm39) D289E probably benign Het
Other mutations in Nbn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00833:Nbn APN 4 15,964,320 (GRCm39) missense probably benign 0.01
IGL00921:Nbn APN 4 15,963,833 (GRCm39) missense possibly damaging 0.85
IGL01621:Nbn APN 4 15,965,221 (GRCm39) missense probably benign 0.45
IGL02372:Nbn APN 4 15,986,613 (GRCm39) missense probably benign 0.00
IGL03392:Nbn APN 4 15,962,362 (GRCm39) missense probably damaging 1.00
nebish UTSW 4 15,965,132 (GRCm39) critical splice acceptor site probably null
zenobia UTSW 4 15,969,391 (GRCm39) missense probably damaging 1.00
R0238:Nbn UTSW 4 15,986,672 (GRCm39) splice site probably benign
R0244:Nbn UTSW 4 15,979,353 (GRCm39) missense probably benign 0.00
R0432:Nbn UTSW 4 15,983,951 (GRCm39) unclassified probably benign
R0946:Nbn UTSW 4 15,970,719 (GRCm39) critical splice acceptor site probably null
R1076:Nbn UTSW 4 15,970,719 (GRCm39) critical splice acceptor site probably null
R1563:Nbn UTSW 4 15,981,668 (GRCm39) missense possibly damaging 0.77
R1579:Nbn UTSW 4 15,964,289 (GRCm39) missense probably damaging 0.99
R1660:Nbn UTSW 4 15,971,771 (GRCm39) missense probably benign 0.06
R1663:Nbn UTSW 4 15,970,903 (GRCm39) missense probably benign 0.13
R2005:Nbn UTSW 4 15,979,351 (GRCm39) missense probably benign 0.01
R2010:Nbn UTSW 4 15,969,393 (GRCm39) missense probably damaging 1.00
R2077:Nbn UTSW 4 15,979,389 (GRCm39) missense probably damaging 1.00
R2228:Nbn UTSW 4 15,970,904 (GRCm39) missense probably benign 0.01
R2229:Nbn UTSW 4 15,970,904 (GRCm39) missense probably benign 0.01
R2356:Nbn UTSW 4 15,970,863 (GRCm39) missense probably damaging 0.96
R2869:Nbn UTSW 4 15,963,810 (GRCm39) missense probably damaging 1.00
R2869:Nbn UTSW 4 15,963,810 (GRCm39) missense probably damaging 1.00
R3508:Nbn UTSW 4 15,962,387 (GRCm39) missense probably damaging 1.00
R3753:Nbn UTSW 4 15,964,269 (GRCm39) missense probably damaging 0.98
R4756:Nbn UTSW 4 15,981,470 (GRCm39) missense probably benign 0.00
R5042:Nbn UTSW 4 15,981,446 (GRCm39) missense probably benign 0.10
R5177:Nbn UTSW 4 15,965,132 (GRCm39) critical splice acceptor site probably null
R5229:Nbn UTSW 4 15,963,893 (GRCm39) missense probably damaging 0.98
R5368:Nbn UTSW 4 15,969,391 (GRCm39) missense probably damaging 1.00
R5431:Nbn UTSW 4 15,986,593 (GRCm39) missense probably benign
R6025:Nbn UTSW 4 15,981,347 (GRCm39) missense probably damaging 0.97
R6375:Nbn UTSW 4 15,979,327 (GRCm39) missense probably benign
R6543:Nbn UTSW 4 15,986,605 (GRCm39) missense probably benign 0.39
R6655:Nbn UTSW 4 15,981,696 (GRCm39) missense probably damaging 0.98
R6965:Nbn UTSW 4 15,970,863 (GRCm39) missense probably benign 0.25
R7090:Nbn UTSW 4 15,981,350 (GRCm39) missense probably benign 0.06
R7159:Nbn UTSW 4 15,983,677 (GRCm39) splice site probably null
R7241:Nbn UTSW 4 15,991,190 (GRCm39) missense probably benign 0.00
R7267:Nbn UTSW 4 15,979,320 (GRCm39) missense probably benign 0.00
R7597:Nbn UTSW 4 15,963,911 (GRCm39) missense probably damaging 1.00
R7937:Nbn UTSW 4 15,958,080 (GRCm39) missense probably damaging 0.99
R8110:Nbn UTSW 4 15,981,588 (GRCm39) missense probably benign 0.02
R8317:Nbn UTSW 4 15,970,893 (GRCm39) missense probably damaging 0.96
R8327:Nbn UTSW 4 15,981,470 (GRCm39) missense probably benign 0.00
R8725:Nbn UTSW 4 15,963,911 (GRCm39) missense probably damaging 1.00
R8727:Nbn UTSW 4 15,963,911 (GRCm39) missense probably damaging 1.00
R8747:Nbn UTSW 4 15,981,555 (GRCm39) missense probably damaging 0.96
R8909:Nbn UTSW 4 15,970,833 (GRCm39) missense probably damaging 1.00
R8973:Nbn UTSW 4 15,986,585 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCCCAAAACAGCTTGAGGT -3'
(R):5'- GGGTCAAGCATCTCTAACAAAGT -3'

Sequencing Primer
(F):5'- TAAAGACAACGACTCCAGG -3'
(R):5'- TATTACACAGACTGAGCGGATTGC -3'
Posted On 2015-03-18