Incidental Mutation 'R3745:Msantd1'
ID 271160
Institutional Source Beutler Lab
Gene Symbol Msantd1
Ensembl Gene ENSMUSG00000051246
Gene Name Myb/SANT-like DNA-binding domain containing 1
Synonyms A930005I04Rik, LOC231132
MMRRC Submission 040731-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R3745 (G1)
Quality Score 225
Status Validated
Chromosome 5
Chromosomal Location 35071581-35084333 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 35080811 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Glutamic Acid at position 155 (V155E)
Ref Sequence ENSEMBL: ENSMUSP00000144008 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050535] [ENSMUST00000202205] [ENSMUST00000212362]
AlphaFold Q8BIL2
Predicted Effect possibly damaging
Transcript: ENSMUST00000050535
AA Change: V247E

PolyPhen 2 Score 0.480 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000057362
Gene: ENSMUSG00000051246
AA Change: V247E

DomainStartEndE-ValueType
Pfam:Myb_DNA-bind_4 43 131 1.1e-14 PFAM
low complexity region 183 203 N/A INTRINSIC
coiled coil region 215 246 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000202205
AA Change: V155E

PolyPhen 2 Score 0.939 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000144008
Gene: ENSMUSG00000051246
AA Change: V155E

DomainStartEndE-ValueType
Pfam:Myb_DNA-bind_4 43 129 9.4e-9 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000212362
AA Change: V234E

PolyPhen 2 Score 0.694 (Sensitivity: 0.86; Specificity: 0.92)
Meta Mutation Damage Score 0.2103 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 98% (44/45)
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012B07Rik G T 11: 109,684,980 (GRCm39) C172* probably null Het
Acot9 G A X: 154,054,941 (GRCm39) probably benign Het
Akap10 A G 11: 61,806,131 (GRCm39) V199A probably benign Het
Aox4 C T 1: 58,285,029 (GRCm39) H594Y probably damaging Het
Arhgap35 A T 7: 16,297,647 (GRCm39) Y473N probably damaging Het
Aspn G A 13: 49,720,036 (GRCm39) E351K probably damaging Het
Astn1 G T 1: 158,329,630 (GRCm39) A162S probably damaging Het
Atosa T C 9: 74,917,144 (GRCm39) V581A probably benign Het
Auts2 A G 5: 131,505,425 (GRCm39) probably benign Het
Cog6 A T 3: 52,900,240 (GRCm39) M507K probably benign Het
Crct1 C A 3: 92,922,014 (GRCm39) probably benign Het
Cyp2d11 A C 15: 82,276,056 (GRCm39) I175S probably benign Het
Dclk1 A G 3: 55,154,863 (GRCm39) N98D possibly damaging Het
Erich5 T A 15: 34,470,878 (GRCm39) C36S probably damaging Het
F5 A G 1: 164,014,348 (GRCm39) I540V possibly damaging Het
Fam20a A T 11: 109,568,616 (GRCm39) S303R probably benign Het
Fat3 G A 9: 15,909,567 (GRCm39) S2145F probably damaging Het
Gbp9 C A 5: 105,253,724 (GRCm39) probably benign Het
Gm6408 G T 5: 146,421,246 (GRCm39) V292F probably damaging Het
Kmt2a A G 9: 44,742,637 (GRCm39) probably benign Het
Lrriq1 T C 10: 103,006,717 (GRCm39) D1136G probably damaging Het
Macrod2 C A 2: 141,652,549 (GRCm39) T204K probably damaging Het
Mlkl A G 8: 112,042,199 (GRCm39) probably benign Het
Myo3b A G 2: 70,064,829 (GRCm39) probably benign Het
Nbn T A 4: 15,976,163 (GRCm39) C375S possibly damaging Het
Nell2 A C 15: 95,330,554 (GRCm39) C231W probably damaging Het
Nipbl A G 15: 8,388,358 (GRCm39) S421P probably benign Het
Npr3 A T 15: 11,905,577 (GRCm39) V50E probably damaging Het
Or4d10 A G 19: 12,051,744 (GRCm39) L84P probably damaging Het
Pclo T C 5: 14,728,435 (GRCm39) probably benign Het
Pkn3 A G 2: 29,980,353 (GRCm39) K785R probably damaging Het
Ppef2 T A 5: 92,387,010 (GRCm39) probably benign Het
Prdm10 T C 9: 31,251,703 (GRCm39) I357T possibly damaging Het
Prrc2c G A 1: 162,525,754 (GRCm39) T284I unknown Het
Psma3 T C 12: 71,025,522 (GRCm39) S13P possibly damaging Het
Ptch1 T G 13: 63,672,773 (GRCm39) E944A probably benign Het
Rpl6l T C 10: 110,962,226 (GRCm39) noncoding transcript Het
Tex11 A G X: 99,960,178 (GRCm39) V522A probably benign Het
Thsd7b A G 1: 129,605,978 (GRCm39) E573G probably benign Het
Tom1l1 A G 11: 90,548,567 (GRCm39) S259P probably benign Het
Trpm8 A G 1: 88,276,049 (GRCm39) E549G probably benign Het
Vmn1r66 C T 7: 10,008,248 (GRCm39) A262T possibly damaging Het
Zc3h13 T A 14: 75,568,101 (GRCm39) D1131E probably benign Het
Zfp445 A C 9: 122,683,791 (GRCm39) D289E probably benign Het
Other mutations in Msantd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02514:Msantd1 APN 5 35,078,887 (GRCm39) missense probably damaging 0.99
IGL02998:Msantd1 APN 5 35,078,768 (GRCm39) missense probably damaging 1.00
G1patch:Msantd1 UTSW 5 35,078,765 (GRCm39) missense probably damaging 1.00
R0538:Msantd1 UTSW 5 35,075,069 (GRCm39) missense probably damaging 1.00
R1658:Msantd1 UTSW 5 35,078,906 (GRCm39) missense probably benign 0.43
R1658:Msantd1 UTSW 5 35,078,905 (GRCm39) missense probably damaging 0.99
R5241:Msantd1 UTSW 5 35,078,813 (GRCm39) missense probably damaging 1.00
R6009:Msantd1 UTSW 5 35,075,049 (GRCm39) missense probably benign 0.45
R6406:Msantd1 UTSW 5 35,080,665 (GRCm39) splice site probably null
R6725:Msantd1 UTSW 5 35,078,765 (GRCm39) missense probably damaging 1.00
R7055:Msantd1 UTSW 5 35,075,005 (GRCm39) missense probably benign
R7327:Msantd1 UTSW 5 35,075,039 (GRCm39) missense probably damaging 1.00
R9265:Msantd1 UTSW 5 35,080,861 (GRCm39) nonsense probably null
R9279:Msantd1 UTSW 5 35,080,885 (GRCm39) missense probably benign
R9623:Msantd1 UTSW 5 35,075,076 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- CATGTTCCAGTCCCTGTGAC -3'
(R):5'- CCTAGAAAGCCCTTCAGAGAAG -3'

Sequencing Primer
(F):5'- GACTAACTTGTCTCTCCCCAACAGG -3'
(R):5'- CCCTTCAGAGAAGCACAGAGG -3'
Posted On 2015-03-18