Incidental Mutation 'R3745:Ppef2'
ID 271161
Institutional Source Beutler Lab
Gene Symbol Ppef2
Ensembl Gene ENSMUSG00000029410
Gene Name protein phosphatase, EF hand calcium-binding domain 2
Synonyms
MMRRC Submission 040731-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R3745 (G1)
Quality Score 183
Status Validated
Chromosome 5
Chromosomal Location 92226679-92256278 bp(-) (GRCm38)
Type of Mutation splice site
DNA Base Change (assembly) T to A at 92239151 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000144157 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031359] [ENSMUST00000201130]
AlphaFold O35385
Predicted Effect probably benign
Transcript: ENSMUST00000031359
SMART Domains Protein: ENSMUSP00000031359
Gene: ENSMUSG00000029410

DomainStartEndE-ValueType
IQ 18 40 3.48e-1 SMART
PP2Ac 141 544 1.97e-118 SMART
EFh 576 604 3.25e1 SMART
EFh 660 688 5.44e-3 SMART
EFh 700 728 1.67e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000201130
SMART Domains Protein: ENSMUSP00000144157
Gene: ENSMUSG00000029410

DomainStartEndE-ValueType
IQ 18 40 3.48e-1 SMART
PP2Ac 141 544 1.97e-118 SMART
EFh 576 604 3.25e1 SMART
EFh 660 688 5.44e-3 SMART
EFh 700 728 1.67e0 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 98% (44/45)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the serine/threonine protein phosphatase with EF-hand motif family. The protein contains a protein phosphatase catalytic domain, and at least two EF-hand calcium-binding motifs in its C terminus. Although its substrate(s) is unknown, the encoded protein, which is expressed specifically in photoreceptors and the pineal, has been suggested to play a role in the visual system. This gene shares high sequence similarity with the Drosophila retinal degeneration C (rdgC) gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation appear to be phenotypically normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012B07Rik G T 11: 109,794,154 C172* probably null Het
Acot9 G A X: 155,271,945 probably benign Het
Akap10 A G 11: 61,915,305 V199A probably benign Het
Aox4 C T 1: 58,245,870 H594Y probably damaging Het
Arhgap35 A T 7: 16,563,722 Y473N probably damaging Het
Aspn G A 13: 49,566,560 E351K probably damaging Het
Astn1 G T 1: 158,502,060 A162S probably damaging Het
Auts2 A G 5: 131,476,587 probably benign Het
Cog6 A T 3: 52,992,819 M507K probably benign Het
Crct1 C A 3: 93,014,707 probably benign Het
Cyp2d11 A C 15: 82,391,855 I175S probably benign Het
Dclk1 A G 3: 55,247,442 N98D possibly damaging Het
Erich5 T A 15: 34,470,732 C36S probably damaging Het
F5 A G 1: 164,186,779 I540V possibly damaging Het
Fam20a A T 11: 109,677,790 S303R probably benign Het
Fam214a T C 9: 75,009,862 V581A probably benign Het
Fat3 G A 9: 15,998,271 S2145F probably damaging Het
Gbp9 C A 5: 105,105,858 probably benign Het
Gm6408 G T 5: 146,484,436 V292F probably damaging Het
Kmt2a A G 9: 44,831,340 probably benign Het
Lrriq1 T C 10: 103,170,856 D1136G probably damaging Het
Macrod2 C A 2: 141,810,629 T204K probably damaging Het
Mlkl A G 8: 111,315,567 probably benign Het
Msantd1 T A 5: 34,923,467 V155E possibly damaging Het
Myo3b A G 2: 70,234,485 probably benign Het
Nbn T A 4: 15,976,163 C375S possibly damaging Het
Nell2 A C 15: 95,432,673 C231W probably damaging Het
Nipbl A G 15: 8,358,874 S421P probably benign Het
Npr3 A T 15: 11,905,491 V50E probably damaging Het
Olfr1425 A G 19: 12,074,380 L84P probably damaging Het
Pclo T C 5: 14,678,421 probably benign Het
Pkn3 A G 2: 30,090,341 K785R probably damaging Het
Prdm10 T C 9: 31,340,407 I357T possibly damaging Het
Prrc2c G A 1: 162,698,185 T284I unknown Het
Psma3 T C 12: 70,978,748 S13P possibly damaging Het
Ptch1 T G 13: 63,524,959 E944A probably benign Het
Rpl6l T C 10: 111,126,365 noncoding transcript Het
Tex11 A G X: 100,916,572 V522A probably benign Het
Thsd7b A G 1: 129,678,241 E573G probably benign Het
Tom1l1 A G 11: 90,657,741 S259P probably benign Het
Trpm8 A G 1: 88,348,327 E549G probably benign Het
Vmn1r66 C T 7: 10,274,321 A262T possibly damaging Het
Zc3h13 T A 14: 75,330,661 D1131E probably benign Het
Zfp445 A C 9: 122,854,726 D289E probably benign Het
Other mutations in Ppef2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01066:Ppef2 APN 5 92234237 missense probably damaging 1.00
IGL01105:Ppef2 APN 5 92249196 missense possibly damaging 0.91
IGL01613:Ppef2 APN 5 92235820 missense probably benign 0.01
IGL01793:Ppef2 APN 5 92246756 missense probably damaging 1.00
IGL02529:Ppef2 APN 5 92244737 missense probably damaging 1.00
IGL02702:Ppef2 APN 5 92231819 missense probably benign 0.01
IGL02992:Ppef2 APN 5 92235900 nonsense probably null
IGL02995:Ppef2 APN 5 92235900 nonsense probably null
IGL02996:Ppef2 APN 5 92235900 nonsense probably null
IGL03169:Ppef2 APN 5 92235900 nonsense probably null
IGL02991:Ppef2 UTSW 5 92235900 nonsense probably null
R0494:Ppef2 UTSW 5 92253093 splice site probably benign
R0659:Ppef2 UTSW 5 92230509 missense probably damaging 1.00
R0781:Ppef2 UTSW 5 92244830 missense probably benign 0.39
R1162:Ppef2 UTSW 5 92253121 missense probably benign 0.00
R1870:Ppef2 UTSW 5 92250512 missense probably damaging 1.00
R2212:Ppef2 UTSW 5 92228722 missense probably damaging 0.97
R2973:Ppef2 UTSW 5 92239094 missense probably benign
R3412:Ppef2 UTSW 5 92228722 missense probably damaging 0.97
R3413:Ppef2 UTSW 5 92228722 missense probably damaging 0.97
R4878:Ppef2 UTSW 5 92228740 splice site probably null
R5027:Ppef2 UTSW 5 92234291 missense probably damaging 1.00
R5156:Ppef2 UTSW 5 92244602 critical splice donor site probably null
R5316:Ppef2 UTSW 5 92235811 missense probably benign 0.00
R5590:Ppef2 UTSW 5 92239139 missense probably damaging 0.99
R5773:Ppef2 UTSW 5 92250561 missense probably damaging 1.00
R5881:Ppef2 UTSW 5 92250529 nonsense probably null
R6032:Ppef2 UTSW 5 92230524 missense probably benign 0.23
R6032:Ppef2 UTSW 5 92230524 missense probably benign 0.23
R6182:Ppef2 UTSW 5 92227066 missense probably damaging 1.00
R6335:Ppef2 UTSW 5 92235754 missense probably damaging 1.00
R6645:Ppef2 UTSW 5 92230461 missense probably benign 0.02
R7448:Ppef2 UTSW 5 92228704 missense probably damaging 1.00
R7576:Ppef2 UTSW 5 92253134 missense possibly damaging 0.87
R7968:Ppef2 UTSW 5 92249163 missense probably damaging 0.99
R7988:Ppef2 UTSW 5 92238982 missense probably benign 0.00
R8200:Ppef2 UTSW 5 92245392 missense probably benign 0.13
R8212:Ppef2 UTSW 5 92228665 missense possibly damaging 0.87
R9687:Ppef2 UTSW 5 92238887 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TTAAAGCCAGAGCCCAGGTG -3'
(R):5'- TATCAGCCTGCCAATTGCGTG -3'

Sequencing Primer
(F):5'- CCAGAGCCCAGGTGAAAAG -3'
(R):5'- ATAAGGGTTGCCATCAAGCTTGTC -3'
Posted On 2015-03-18