Mutagenetix > Incidental Mutations

Incidental Mutation 'R3745:Ppef2'

271161

Institutional Source

Beutler Lab

Gene Symbol

Ppef2

Ensembl Gene

ENSMUSG00000029410

Gene Name

protein phosphatase, EF hand calcium-binding domain 2

Synonyms

MMRRC Submission

040731-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R3745 (G1)

Quality Score

183

Status

Validated

Chromosome

Chromosomal Location

92226679-92256278 bp(-) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

T to A at 92239151 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000144157 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000031359] [ENSMUST00000201130]

Predicted Effect

probably benign
Transcript: ENSMUST00000031359

SMART Domains

Protein: ENSMUSP00000031359
Gene: ENSMUSG00000029410

Domain	Start	End	E-Value	Type
IQ	18	40	3.48e-1	SMART
PP2Ac	141	544	1.97e-118	SMART
EFh	576	604	3.25e1	SMART
EFh	660	688	5.44e-3	SMART
EFh	700	728	1.67e0	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000201130

SMART Domains

Protein: ENSMUSP00000144157
Gene: ENSMUSG00000029410

Domain	Start	End	E-Value	Type
IQ	18	40	3.48e-1	SMART
PP2Ac	141	544	1.97e-118	SMART
EFh	576	604	3.25e1	SMART
EFh	660	688	5.44e-3	SMART
EFh	700	728	1.67e0	SMART

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 94.8%

Validation Efficiency

98% (44/45)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the serine/threonine protein phosphatase with EF-hand motif family. The protein contains a protein phosphatase catalytic domain, and at least two EF-hand calcium-binding motifs in its C terminus. Although its substrate(s) is unknown, the encoded protein, which is expressed specifically in photoreceptors and the pineal, has been suggested to play a role in the visual system. This gene shares high sequence similarity with the Drosophila retinal degeneration C (rdgC) gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation appear to be phenotypically normal. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 44 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700012B07Rik	G	T	11: 109,794,154	C172*	probably null	Het
Acot9	G	A	X: 155,271,945		probably benign	Het
Akap10	A	G	11: 61,915,305	V199A	probably benign	Het
Aox4	C	T	1: 58,245,870	H594Y	probably damaging	Het
Arhgap35	A	T	7: 16,563,722	Y473N	probably damaging	Het
Aspn	G	A	13: 49,566,560	E351K	probably damaging	Het
Astn1	G	T	1: 158,502,060	A162S	probably damaging	Het
Auts2	A	G	5: 131,476,587		probably benign	Het
Cog6	A	T	3: 52,992,819	M507K	probably benign	Het
Crct1	C	A	3: 93,014,707		probably benign	Het
Cyp2d11	A	C	15: 82,391,855	I175S	probably benign	Het
Dclk1	A	G	3: 55,247,442	N98D	possibly damaging	Het
Erich5	T	A	15: 34,470,732	C36S	probably damaging	Het
F5	A	G	1: 164,186,779	I540V	possibly damaging	Het
Fam20a	A	T	11: 109,677,790	S303R	probably benign	Het
Fam214a	T	C	9: 75,009,862	V581A	probably benign	Het
Fat3	G	A	9: 15,998,271	S2145F	probably damaging	Het
Gbp9	C	A	5: 105,105,858		probably benign	Het
Gm6408	G	T	5: 146,484,436	V292F	probably damaging	Het
Kmt2a	A	G	9: 44,831,340		probably benign	Het
Lrriq1	T	C	10: 103,170,856	D1136G	probably damaging	Het
Macrod2	C	A	2: 141,810,629	T204K	probably damaging	Het
Mlkl	A	G	8: 111,315,567		probably benign	Het
Msantd1	T	A	5: 34,923,467	V155E	possibly damaging	Het
Myo3b	A	G	2: 70,234,485		probably benign	Het
Nbn	T	A	4: 15,976,163	C375S	possibly damaging	Het
Nell2	A	C	15: 95,432,673	C231W	probably damaging	Het
Nipbl	A	G	15: 8,358,874	S421P	probably benign	Het
Npr3	A	T	15: 11,905,491	V50E	probably damaging	Het
Olfr1425	A	G	19: 12,074,380	L84P	probably damaging	Het
Pclo	T	C	5: 14,678,421		probably benign	Het
Pkn3	A	G	2: 30,090,341	K785R	probably damaging	Het
Prdm10	T	C	9: 31,340,407	I357T	possibly damaging	Het
Prrc2c	G	A	1: 162,698,185	T284I	unknown	Het
Psma3	T	C	12: 70,978,748	S13P	possibly damaging	Het
Ptch1	T	G	13: 63,524,959	E944A	probably benign	Het
Rpl6l	T	C	10: 111,126,365		noncoding transcript	Het
Tex11	A	G	X: 100,916,572	V522A	probably benign	Het
Thsd7b	A	G	1: 129,678,241	E573G	probably benign	Het
Tom1l1	A	G	11: 90,657,741	S259P	probably benign	Het
Trpm8	A	G	1: 88,348,327	E549G	probably benign	Het
Vmn1r66	C	T	7: 10,274,321	A262T	possibly damaging	Het
Zc3h13	T	A	14: 75,330,661	D1131E	probably benign	Het
Zfp445	A	C	9: 122,854,726	D289E	probably benign	Het

Other mutations in Ppef2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01066:Ppef2	APN	5	92234237	missense	probably damaging	1.00
IGL01105:Ppef2	APN	5	92249196	missense	possibly damaging	0.91
IGL01613:Ppef2	APN	5	92235820	missense	probably benign	0.01
IGL01793:Ppef2	APN	5	92246756	missense	probably damaging	1.00
IGL02529:Ppef2	APN	5	92244737	missense	probably damaging	1.00
IGL02702:Ppef2	APN	5	92231819	missense	probably benign	0.01
IGL02992:Ppef2	APN	5	92235900	nonsense	probably null
IGL02995:Ppef2	APN	5	92235900	nonsense	probably null
IGL02996:Ppef2	APN	5	92235900	nonsense	probably null
IGL03169:Ppef2	APN	5	92235900	nonsense	probably null
IGL02991:Ppef2	UTSW	5	92235900	nonsense	probably null
R0494:Ppef2	UTSW	5	92253093	splice site	probably benign
R0659:Ppef2	UTSW	5	92230509	missense	probably damaging	1.00
R0781:Ppef2	UTSW	5	92244830	missense	probably benign	0.39
R1162:Ppef2	UTSW	5	92253121	missense	probably benign	0.00
R1870:Ppef2	UTSW	5	92250512	missense	probably damaging	1.00
R2212:Ppef2	UTSW	5	92228722	missense	probably damaging	0.97
R2973:Ppef2	UTSW	5	92239094	missense	probably benign
R3412:Ppef2	UTSW	5	92228722	missense	probably damaging	0.97
R3413:Ppef2	UTSW	5	92228722	missense	probably damaging	0.97
R4878:Ppef2	UTSW	5	92228740	splice site	probably null
R5027:Ppef2	UTSW	5	92234291	missense	probably damaging	1.00
R5156:Ppef2	UTSW	5	92244602	critical splice donor site	probably null
R5316:Ppef2	UTSW	5	92235811	missense	probably benign	0.00
R5590:Ppef2	UTSW	5	92239139	missense	probably damaging	0.99
R5773:Ppef2	UTSW	5	92250561	missense	probably damaging	1.00
R5881:Ppef2	UTSW	5	92250529	nonsense	probably null
R6032:Ppef2	UTSW	5	92230524	missense	probably benign	0.23
R6032:Ppef2	UTSW	5	92230524	missense	probably benign	0.23
R6182:Ppef2	UTSW	5	92227066	missense	probably damaging	1.00
R6335:Ppef2	UTSW	5	92235754	missense	probably damaging	1.00
R6645:Ppef2	UTSW	5	92230461	missense	probably benign	0.02
R7448:Ppef2	UTSW	5	92228704	missense	probably damaging	1.00
R7576:Ppef2	UTSW	5	92253134	missense	possibly damaging	0.87
R7968:Ppef2	UTSW	5	92249163	missense	probably damaging	0.99
R7988:Ppef2	UTSW	5	92238982	missense	probably benign	0.00
R8200:Ppef2	UTSW	5	92245392	missense	probably benign	0.13
R8212:Ppef2	UTSW	5	92228665	missense	possibly damaging	0.87

Predicted Primers

PCR Primer
(F):5'- TTAAAGCCAGAGCCCAGGTG -3'
(R):5'- TATCAGCCTGCCAATTGCGTG -3'

Sequencing Primer
(F):5'- CCAGAGCCCAGGTGAAAAG -3'
(R):5'- ATAAGGGTTGCCATCAAGCTTGTC -3'

Posted On

2015-03-18