Incidental Mutation 'R3745:Gbp9'
ID 271162
Institutional Source Beutler Lab
Gene Symbol Gbp9
Ensembl Gene ENSMUSG00000029298
Gene Name guanylate-binding protein 9
Synonyms
MMRRC Submission 040731-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.054) question?
Stock # R3745 (G1)
Quality Score 225
Status Validated
Chromosome 5
Chromosomal Location 105224332-105258255 bp(-) (GRCm39)
Type of Mutation start gained
DNA Base Change (assembly) C to A at 105253724 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000098521 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031235] [ENSMUST00000031238] [ENSMUST00000100961]
AlphaFold Q8BTS3
Predicted Effect probably benign
Transcript: ENSMUST00000031235
SMART Domains Protein: ENSMUSP00000031235
Gene: ENSMUSG00000034438

DomainStartEndE-ValueType
Pfam:GBP 16 213 5.4e-91 PFAM
Pfam:GBP_C 206 493 1e-115 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000031238
SMART Domains Protein: ENSMUSP00000031238
Gene: ENSMUSG00000029298

DomainStartEndE-ValueType
Pfam:GBP 16 279 1.2e-117 PFAM
Pfam:GBP_C 281 575 4.5e-115 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000100961
SMART Domains Protein: ENSMUSP00000098521
Gene: ENSMUSG00000029298

DomainStartEndE-ValueType
Pfam:GBP 16 279 3.8e-124 PFAM
Pfam:GBP_C 281 575 4.5e-115 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196820
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 98% (44/45)
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012B07Rik G T 11: 109,684,980 (GRCm39) C172* probably null Het
Acot9 G A X: 154,054,941 (GRCm39) probably benign Het
Akap10 A G 11: 61,806,131 (GRCm39) V199A probably benign Het
Aox4 C T 1: 58,285,029 (GRCm39) H594Y probably damaging Het
Arhgap35 A T 7: 16,297,647 (GRCm39) Y473N probably damaging Het
Aspn G A 13: 49,720,036 (GRCm39) E351K probably damaging Het
Astn1 G T 1: 158,329,630 (GRCm39) A162S probably damaging Het
Atosa T C 9: 74,917,144 (GRCm39) V581A probably benign Het
Auts2 A G 5: 131,505,425 (GRCm39) probably benign Het
Cog6 A T 3: 52,900,240 (GRCm39) M507K probably benign Het
Crct1 C A 3: 92,922,014 (GRCm39) probably benign Het
Cyp2d11 A C 15: 82,276,056 (GRCm39) I175S probably benign Het
Dclk1 A G 3: 55,154,863 (GRCm39) N98D possibly damaging Het
Erich5 T A 15: 34,470,878 (GRCm39) C36S probably damaging Het
F5 A G 1: 164,014,348 (GRCm39) I540V possibly damaging Het
Fam20a A T 11: 109,568,616 (GRCm39) S303R probably benign Het
Fat3 G A 9: 15,909,567 (GRCm39) S2145F probably damaging Het
Gm6408 G T 5: 146,421,246 (GRCm39) V292F probably damaging Het
Kmt2a A G 9: 44,742,637 (GRCm39) probably benign Het
Lrriq1 T C 10: 103,006,717 (GRCm39) D1136G probably damaging Het
Macrod2 C A 2: 141,652,549 (GRCm39) T204K probably damaging Het
Mlkl A G 8: 112,042,199 (GRCm39) probably benign Het
Msantd1 T A 5: 35,080,811 (GRCm39) V155E possibly damaging Het
Myo3b A G 2: 70,064,829 (GRCm39) probably benign Het
Nbn T A 4: 15,976,163 (GRCm39) C375S possibly damaging Het
Nell2 A C 15: 95,330,554 (GRCm39) C231W probably damaging Het
Nipbl A G 15: 8,388,358 (GRCm39) S421P probably benign Het
Npr3 A T 15: 11,905,577 (GRCm39) V50E probably damaging Het
Or4d10 A G 19: 12,051,744 (GRCm39) L84P probably damaging Het
Pclo T C 5: 14,728,435 (GRCm39) probably benign Het
Pkn3 A G 2: 29,980,353 (GRCm39) K785R probably damaging Het
Ppef2 T A 5: 92,387,010 (GRCm39) probably benign Het
Prdm10 T C 9: 31,251,703 (GRCm39) I357T possibly damaging Het
Prrc2c G A 1: 162,525,754 (GRCm39) T284I unknown Het
Psma3 T C 12: 71,025,522 (GRCm39) S13P possibly damaging Het
Ptch1 T G 13: 63,672,773 (GRCm39) E944A probably benign Het
Rpl6l T C 10: 110,962,226 (GRCm39) noncoding transcript Het
Tex11 A G X: 99,960,178 (GRCm39) V522A probably benign Het
Thsd7b A G 1: 129,605,978 (GRCm39) E573G probably benign Het
Tom1l1 A G 11: 90,548,567 (GRCm39) S259P probably benign Het
Trpm8 A G 1: 88,276,049 (GRCm39) E549G probably benign Het
Vmn1r66 C T 7: 10,008,248 (GRCm39) A262T possibly damaging Het
Zc3h13 T A 14: 75,568,101 (GRCm39) D1131E probably benign Het
Zfp445 A C 9: 122,683,791 (GRCm39) D289E probably benign Het
Other mutations in Gbp9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:Gbp9 APN 5 105,229,130 (GRCm39) missense probably benign 0.01
IGL00419:Gbp9 APN 5 105,241,943 (GRCm39) missense probably benign 0.05
IGL00425:Gbp9 APN 5 105,253,620 (GRCm39) missense possibly damaging 0.82
IGL00597:Gbp9 APN 5 105,242,364 (GRCm39) missense probably damaging 1.00
IGL01362:Gbp9 APN 5 105,228,072 (GRCm39) missense probably damaging 1.00
IGL01679:Gbp9 APN 5 105,233,038 (GRCm39) splice site probably null
IGL01803:Gbp9 APN 5 105,232,884 (GRCm39) missense probably damaging 0.99
IGL01803:Gbp9 APN 5 105,242,039 (GRCm39) missense probably damaging 1.00
IGL02054:Gbp9 APN 5 105,230,673 (GRCm39) missense probably benign 0.12
IGL02474:Gbp9 APN 5 105,242,433 (GRCm39) splice site probably benign
IGL02633:Gbp9 APN 5 105,231,431 (GRCm39) splice site probably benign
IGL02666:Gbp9 APN 5 105,242,141 (GRCm39) splice site probably null
IGL02689:Gbp9 APN 5 105,253,662 (GRCm39) missense probably benign 0.11
IGL02812:Gbp9 APN 5 105,231,624 (GRCm39) missense probably damaging 1.00
IGL03132:Gbp9 APN 5 105,232,819 (GRCm39) missense possibly damaging 0.83
IGL03274:Gbp9 APN 5 105,230,652 (GRCm39) missense possibly damaging 0.58
R0410:Gbp9 UTSW 5 105,232,939 (GRCm39) missense probably benign 0.17
R1018:Gbp9 UTSW 5 105,228,126 (GRCm39) missense probably benign 0.15
R1479:Gbp9 UTSW 5 105,241,930 (GRCm39) splice site probably benign
R1655:Gbp9 UTSW 5 105,229,558 (GRCm39) missense possibly damaging 0.76
R1658:Gbp9 UTSW 5 105,242,334 (GRCm39) missense probably damaging 0.98
R1757:Gbp9 UTSW 5 105,242,319 (GRCm39) missense probably damaging 1.00
R1950:Gbp9 UTSW 5 105,229,112 (GRCm39) missense probably benign 0.01
R1986:Gbp9 UTSW 5 105,253,652 (GRCm39) missense probably damaging 0.98
R1986:Gbp9 UTSW 5 105,253,590 (GRCm39) missense probably damaging 1.00
R2124:Gbp9 UTSW 5 105,242,409 (GRCm39) missense probably damaging 1.00
R2302:Gbp9 UTSW 5 105,241,958 (GRCm39) missense possibly damaging 0.47
R2378:Gbp9 UTSW 5 105,228,042 (GRCm39) missense probably benign 0.02
R2997:Gbp9 UTSW 5 105,230,635 (GRCm39) missense probably benign 0.00
R4182:Gbp9 UTSW 5 105,231,461 (GRCm39) missense probably benign 0.08
R4485:Gbp9 UTSW 5 105,231,674 (GRCm39) missense probably damaging 0.97
R4718:Gbp9 UTSW 5 105,231,624 (GRCm39) missense probably damaging 1.00
R5063:Gbp9 UTSW 5 105,233,028 (GRCm39) missense probably benign
R5099:Gbp9 UTSW 5 105,242,379 (GRCm39) missense probably damaging 1.00
R5104:Gbp9 UTSW 5 105,228,007 (GRCm39) missense probably benign 0.00
R5199:Gbp9 UTSW 5 105,231,678 (GRCm39) missense probably benign 0.04
R5712:Gbp9 UTSW 5 105,242,421 (GRCm39) missense possibly damaging 0.80
R5751:Gbp9 UTSW 5 105,229,124 (GRCm39) missense probably benign 0.06
R5895:Gbp9 UTSW 5 105,230,724 (GRCm39) missense probably damaging 1.00
R6360:Gbp9 UTSW 5 105,231,596 (GRCm39) missense probably benign 0.03
R6646:Gbp9 UTSW 5 105,230,769 (GRCm39) missense probably benign 0.13
R7559:Gbp9 UTSW 5 105,232,975 (GRCm39) missense probably damaging 1.00
R7819:Gbp9 UTSW 5 105,251,745 (GRCm39) missense possibly damaging 0.65
R8042:Gbp9 UTSW 5 105,242,108 (GRCm39) missense probably damaging 1.00
R8288:Gbp9 UTSW 5 105,253,599 (GRCm39) missense probably damaging 1.00
R8303:Gbp9 UTSW 5 105,229,171 (GRCm39) missense possibly damaging 0.94
R8354:Gbp9 UTSW 5 105,242,027 (GRCm39) missense probably damaging 0.97
R8395:Gbp9 UTSW 5 105,228,069 (GRCm39) missense probably damaging 1.00
R8397:Gbp9 UTSW 5 105,231,464 (GRCm39) missense possibly damaging 0.94
R8751:Gbp9 UTSW 5 105,229,117 (GRCm39) missense possibly damaging 0.49
R8808:Gbp9 UTSW 5 105,232,875 (GRCm39) missense probably damaging 1.00
R9105:Gbp9 UTSW 5 105,241,942 (GRCm39) missense probably benign 0.11
R9116:Gbp9 UTSW 5 105,231,695 (GRCm39) missense
R9354:Gbp9 UTSW 5 105,232,825 (GRCm39) missense possibly damaging 0.79
R9513:Gbp9 UTSW 5 105,229,091 (GRCm39) missense probably benign 0.06
R9709:Gbp9 UTSW 5 105,231,542 (GRCm39) missense probably damaging 0.99
R9717:Gbp9 UTSW 5 105,253,587 (GRCm39) nonsense probably null
Z1088:Gbp9 UTSW 5 105,241,991 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CGCCAGACAGTTCATCAAATAGG -3'
(R):5'- GTAGCCCATGTGTTACCAAATC -3'

Sequencing Primer
(F):5'- AGGACTTCCCTGTACGGTACAATC -3'
(R):5'- CCCATGTGTTACCAAATCTTCTTTAG -3'
Posted On 2015-03-18