Incidental Mutation 'R3745:Vmn1r66'
ID271164
Institutional Source Beutler Lab
Gene Symbol Vmn1r66
Ensembl Gene ENSMUSG00000043066
Gene Namevomeronasal 1 receptor 66
SynonymsV1re11
MMRRC Submission 040731-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.059) question?
Stock #R3745 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location10272991-10278006 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 10274321 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 262 (A262T)
Ref Sequence ENSEMBL: ENSMUSP00000153860 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060374] [ENSMUST00000227719] [ENSMUST00000228086] [ENSMUST00000228622]
Predicted Effect possibly damaging
Transcript: ENSMUST00000060374
AA Change: A262T

PolyPhen 2 Score 0.643 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000055861
Gene: ENSMUSG00000043066
AA Change: A262T

DomainStartEndE-ValueType
Pfam:V1R 39 295 4.5e-28 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226202
Predicted Effect possibly damaging
Transcript: ENSMUST00000227719
AA Change: A262T

PolyPhen 2 Score 0.643 (Sensitivity: 0.87; Specificity: 0.91)
Predicted Effect possibly damaging
Transcript: ENSMUST00000228086
AA Change: A262T

PolyPhen 2 Score 0.643 (Sensitivity: 0.87; Specificity: 0.91)
Predicted Effect possibly damaging
Transcript: ENSMUST00000228622
AA Change: A262T

PolyPhen 2 Score 0.643 (Sensitivity: 0.87; Specificity: 0.91)
Meta Mutation Damage Score 0.1188 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 98% (44/45)
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012B07Rik G T 11: 109,794,154 C172* probably null Het
Acot9 G A X: 155,271,945 probably benign Het
Akap10 A G 11: 61,915,305 V199A probably benign Het
Aox4 C T 1: 58,245,870 H594Y probably damaging Het
Arhgap35 A T 7: 16,563,722 Y473N probably damaging Het
Aspn G A 13: 49,566,560 E351K probably damaging Het
Astn1 G T 1: 158,502,060 A162S probably damaging Het
Auts2 A G 5: 131,476,587 probably benign Het
Cog6 A T 3: 52,992,819 M507K probably benign Het
Crct1 C A 3: 93,014,707 probably benign Het
Cyp2d11 A C 15: 82,391,855 I175S probably benign Het
Dclk1 A G 3: 55,247,442 N98D possibly damaging Het
Erich5 T A 15: 34,470,732 C36S probably damaging Het
F5 A G 1: 164,186,779 I540V possibly damaging Het
Fam20a A T 11: 109,677,790 S303R probably benign Het
Fam214a T C 9: 75,009,862 V581A probably benign Het
Fat3 G A 9: 15,998,271 S2145F probably damaging Het
Gbp9 C A 5: 105,105,858 probably benign Het
Gm6408 G T 5: 146,484,436 V292F probably damaging Het
Kmt2a A G 9: 44,831,340 probably benign Het
Lrriq1 T C 10: 103,170,856 D1136G probably damaging Het
Macrod2 C A 2: 141,810,629 T204K probably damaging Het
Mlkl A G 8: 111,315,567 probably benign Het
Msantd1 T A 5: 34,923,467 V155E possibly damaging Het
Myo3b A G 2: 70,234,485 probably benign Het
Nbn T A 4: 15,976,163 C375S possibly damaging Het
Nell2 A C 15: 95,432,673 C231W probably damaging Het
Nipbl A G 15: 8,358,874 S421P probably benign Het
Npr3 A T 15: 11,905,491 V50E probably damaging Het
Olfr1425 A G 19: 12,074,380 L84P probably damaging Het
Pclo T C 5: 14,678,421 probably benign Het
Pkn3 A G 2: 30,090,341 K785R probably damaging Het
Ppef2 T A 5: 92,239,151 probably benign Het
Prdm10 T C 9: 31,340,407 I357T possibly damaging Het
Prrc2c G A 1: 162,698,185 T284I unknown Het
Psma3 T C 12: 70,978,748 S13P possibly damaging Het
Ptch1 T G 13: 63,524,959 E944A probably benign Het
Rpl6l T C 10: 111,126,365 noncoding transcript Het
Tex11 A G X: 100,916,572 V522A probably benign Het
Thsd7b A G 1: 129,678,241 E573G probably benign Het
Tom1l1 A G 11: 90,657,741 S259P probably benign Het
Trpm8 A G 1: 88,348,327 E549G probably benign Het
Zc3h13 T A 14: 75,330,661 D1131E probably benign Het
Zfp445 A C 9: 122,854,726 D289E probably benign Het
Other mutations in Vmn1r66
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02957:Vmn1r66 APN 7 10274810 missense probably damaging 1.00
IGL03236:Vmn1r66 APN 7 10275063 missense probably damaging 0.98
R0380:Vmn1r66 UTSW 7 10274743 missense probably benign 0.02
R1625:Vmn1r66 UTSW 7 10274389 missense probably benign 0.00
R4081:Vmn1r66 UTSW 7 10274806 missense probably damaging 1.00
R4389:Vmn1r66 UTSW 7 10274788 nonsense probably null
R5081:Vmn1r66 UTSW 7 10274795 missense probably damaging 1.00
R5909:Vmn1r66 UTSW 7 10274342 missense probably benign 0.44
R6164:Vmn1r66 UTSW 7 10274402 nonsense probably null
R6792:Vmn1r66 UTSW 7 10274485 missense possibly damaging 0.78
R6843:Vmn1r66 UTSW 7 10274765 missense probably damaging 1.00
R7013:Vmn1r66 UTSW 7 10274756 missense possibly damaging 0.94
R7173:Vmn1r66 UTSW 7 10274555 missense probably benign 0.00
R7400:Vmn1r66 UTSW 7 10274947 missense probably damaging 0.99
Z1176:Vmn1r66 UTSW 7 10274285 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CTGAGGAGTTCAATTCTCTGCATTG -3'
(R):5'- AGTGGCTCTATGACTGTCATTC -3'

Sequencing Primer
(F):5'- CTCTGCATTGAACTTTTGAGAAAG -3'
(R):5'- GGCTCTATGACTGTCATTCTATACAG -3'
Posted On2015-03-18