Mutagenetix > Incidental Mutation

Incidental Mutation 'R3745:Arhgap35'

271165

Institutional Source

Beutler Lab

Gene Symbol

Arhgap35

Ensembl Gene

ENSMUSG00000058230

Gene Name

Rho GTPase activating protein 35

Synonyms

p190RhoGAP, p190A, Grlf1, P190 RhoGAP, 6430596G11Rik

MMRRC Submission

040731-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R3745 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

16493719-16614993 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 16563722 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Asparagine at position 473 (Y473N)

Ref Sequence

ENSEMBL: ENSMUSP00000127379 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000075845] [ENSMUST00000171937]

AlphaFold

Q91YM2

Predicted Effect

probably damaging
Transcript: ENSMUST00000075845
AA Change: Y473N

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000075242
Gene: ENSMUSG00000058230
AA Change: Y473N

Domain	Start	End	E-Value	Type
Pfam:Ras	154	249	6.1e-7	PFAM
FF	270	327	5.76e-9	SMART
FF	369	422	1.1e-5	SMART
FF	429	483	7.43e-12	SMART
FF	485	539	2.02e-4	SMART
Blast:RhoGAP	733	796	1e-7	BLAST
low complexity region	1037	1048	N/A	INTRINSIC
low complexity region	1214	1225	N/A	INTRINSIC
low complexity region	1227	1235	N/A	INTRINSIC
RhoGAP	1259	1433	8.14e-72	SMART
low complexity region	1444	1457	N/A	INTRINSIC
low complexity region	1462	1494	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000171937
AA Change: Y473N

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000127379
Gene: ENSMUSG00000058230
AA Change: Y473N

Domain	Start	End	E-Value	Type
Pfam:Ras	154	249	6e-7	PFAM
FF	270	327	5.76e-9	SMART
FF	369	422	1.1e-5	SMART
FF	429	483	7.43e-12	SMART
FF	485	539	2.02e-4	SMART
Blast:RhoGAP	733	796	1e-7	BLAST
low complexity region	1037	1048	N/A	INTRINSIC
low complexity region	1214	1225	N/A	INTRINSIC
low complexity region	1227	1235	N/A	INTRINSIC
RhoGAP	1259	1433	8.14e-72	SMART
low complexity region	1444	1457	N/A	INTRINSIC
low complexity region	1462	1494	N/A	INTRINSIC

Meta Mutation Damage Score

0.1056

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 94.8%

Validation Efficiency

98% (44/45)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The human glucocorticoid receptor DNA binding factor, which associates with the promoter region of the glucocorticoid receptor gene (hGR gene), is a repressor of glucocorticoid receptor transcription. The amino acid sequence deduced from the cDNA sequences show the presence of three sequence motifs characteristic of a zinc finger and one motif suggestive of a leucine zipper in which 1 cysteine is found instead of all leucines. The GRLF1 enhances the homologous down-regulation of wild-type hGR gene expression. Biochemical analysis suggests that GRLF1 interaction is sequence specific and that transcriptional efficacy of GRLF1 is regulated through its interaction with specific sequence motif. The level of expression is regulated by glucocorticoids. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene usually die within 2 days of birth and never survive beyond 3 weeks. Observed phenotypes include defects in eye morphogenesis, forebrain development, neural tube closure, axon guidance and fasciculation, and renal abnormalities, including hypoplastic and glomerulocystic kidneys, associated with a ciliogenesis defect. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 44 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700012B07Rik	G	T	11: 109,794,154	C172*	probably null	Het
Acot9	G	A	X: 155,271,945		probably benign	Het
Akap10	A	G	11: 61,915,305	V199A	probably benign	Het
Aox4	C	T	1: 58,245,870	H594Y	probably damaging	Het
Aspn	G	A	13: 49,566,560	E351K	probably damaging	Het
Astn1	G	T	1: 158,502,060	A162S	probably damaging	Het
Auts2	A	G	5: 131,476,587		probably benign	Het
Cog6	A	T	3: 52,992,819	M507K	probably benign	Het
Crct1	C	A	3: 93,014,707		probably benign	Het
Cyp2d11	A	C	15: 82,391,855	I175S	probably benign	Het
Dclk1	A	G	3: 55,247,442	N98D	possibly damaging	Het
Erich5	T	A	15: 34,470,732	C36S	probably damaging	Het
F5	A	G	1: 164,186,779	I540V	possibly damaging	Het
Fam20a	A	T	11: 109,677,790	S303R	probably benign	Het
Fam214a	T	C	9: 75,009,862	V581A	probably benign	Het
Fat3	G	A	9: 15,998,271	S2145F	probably damaging	Het
Gbp9	C	A	5: 105,105,858		probably benign	Het
Gm6408	G	T	5: 146,484,436	V292F	probably damaging	Het
Kmt2a	A	G	9: 44,831,340		probably benign	Het
Lrriq1	T	C	10: 103,170,856	D1136G	probably damaging	Het
Macrod2	C	A	2: 141,810,629	T204K	probably damaging	Het
Mlkl	A	G	8: 111,315,567		probably benign	Het
Msantd1	T	A	5: 34,923,467	V155E	possibly damaging	Het
Myo3b	A	G	2: 70,234,485		probably benign	Het
Nbn	T	A	4: 15,976,163	C375S	possibly damaging	Het
Nell2	A	C	15: 95,432,673	C231W	probably damaging	Het
Nipbl	A	G	15: 8,358,874	S421P	probably benign	Het
Npr3	A	T	15: 11,905,491	V50E	probably damaging	Het
Olfr1425	A	G	19: 12,074,380	L84P	probably damaging	Het
Pclo	T	C	5: 14,678,421		probably benign	Het
Pkn3	A	G	2: 30,090,341	K785R	probably damaging	Het
Ppef2	T	A	5: 92,239,151		probably benign	Het
Prdm10	T	C	9: 31,340,407	I357T	possibly damaging	Het
Prrc2c	G	A	1: 162,698,185	T284I	unknown	Het
Psma3	T	C	12: 70,978,748	S13P	possibly damaging	Het
Ptch1	T	G	13: 63,524,959	E944A	probably benign	Het
Rpl6l	T	C	10: 111,126,365		noncoding transcript	Het
Tex11	A	G	X: 100,916,572	V522A	probably benign	Het
Thsd7b	A	G	1: 129,678,241	E573G	probably benign	Het
Tom1l1	A	G	11: 90,657,741	S259P	probably benign	Het
Trpm8	A	G	1: 88,348,327	E549G	probably benign	Het
Vmn1r66	C	T	7: 10,274,321	A262T	possibly damaging	Het
Zc3h13	T	A	14: 75,330,661	D1131E	probably benign	Het
Zfp445	A	C	9: 122,854,726	D289E	probably benign	Het

Other mutations in Arhgap35

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00557:Arhgap35	APN	7	16564415	missense	probably benign	0.03
IGL00684:Arhgap35	APN	7	16561700	missense	possibly damaging	0.93
IGL01385:Arhgap35	APN	7	16564474	missense	probably damaging	0.96
IGL01411:Arhgap35	APN	7	16564267	missense	probably benign
IGL01922:Arhgap35	APN	7	16564255	missense	possibly damaging	0.73
IGL01977:Arhgap35	APN	7	16563203	missense	probably damaging	1.00
IGL02074:Arhgap35	APN	7	16563055	missense	probably benign	0.19
IGL02305:Arhgap35	APN	7	16563665	missense	probably benign	0.15
IGL02342:Arhgap35	APN	7	16562380	missense	probably benign	0.12
IGL02973:Arhgap35	APN	7	16562878	missense	possibly damaging	0.50
IGL02989:Arhgap35	APN	7	16497655	makesense	probably null
PIT4382001:Arhgap35	UTSW	7	16563869	missense	possibly damaging	0.95
PIT4431001:Arhgap35	UTSW	7	16561611	missense	possibly damaging	0.87
R0047:Arhgap35	UTSW	7	16561992	missense	probably benign	0.17
R1690:Arhgap35	UTSW	7	16563281	missense	probably damaging	1.00
R1820:Arhgap35	UTSW	7	16561949	missense	possibly damaging	0.92
R2036:Arhgap35	UTSW	7	16563133	missense	probably damaging	1.00
R2205:Arhgap35	UTSW	7	16498025	splice site	probably null
R2292:Arhgap35	UTSW	7	16563551	missense	probably damaging	1.00
R3079:Arhgap35	UTSW	7	16562576	missense	probably damaging	1.00
R3762:Arhgap35	UTSW	7	16565075	missense	probably damaging	0.98
R4661:Arhgap35	UTSW	7	16564738	missense	probably damaging	1.00
R4709:Arhgap35	UTSW	7	16563586	missense	probably damaging	0.97
R4749:Arhgap35	UTSW	7	16498626	missense	possibly damaging	0.95
R5081:Arhgap35	UTSW	7	16565134	missense	possibly damaging	0.71
R5131:Arhgap35	UTSW	7	16511187	splice site	probably null
R5175:Arhgap35	UTSW	7	16562599	missense	probably damaging	1.00
R5440:Arhgap35	UTSW	7	16562924	missense	probably damaging	1.00
R5517:Arhgap35	UTSW	7	16563489	missense	probably damaging	1.00
R5987:Arhgap35	UTSW	7	16563467	missense	possibly damaging	0.84
R6087:Arhgap35	UTSW	7	16563643	missense	probably damaging	1.00
R6139:Arhgap35	UTSW	7	16563467	missense	possibly damaging	0.84
R6396:Arhgap35	UTSW	7	16562299	missense	probably damaging	0.99
R6878:Arhgap35	UTSW	7	16565113	missense	probably benign	0.00
R7063:Arhgap35	UTSW	7	16565113	missense	probably benign	0.00
R7150:Arhgap35	UTSW	7	16562566	missense	probably damaging	0.96
R7269:Arhgap35	UTSW	7	16561727	missense	probably benign
R7276:Arhgap35	UTSW	7	16564568	missense	probably damaging	1.00
R7517:Arhgap35	UTSW	7	16562207	missense	probably benign	0.31
R7593:Arhgap35	UTSW	7	16564861	missense	probably damaging	1.00
R7775:Arhgap35	UTSW	7	16562648	missense	probably benign	0.01
R7792:Arhgap35	UTSW	7	16561528	missense	possibly damaging	0.88
R8101:Arhgap35	UTSW	7	16562319	missense	probably benign	0.00
R8873:Arhgap35	UTSW	7	16561490	missense	possibly damaging	0.92
R8956:Arhgap35	UTSW	7	16614479	start gained	probably benign
R9163:Arhgap35	UTSW	7	16561624	missense	possibly damaging	0.94
R9507:Arhgap35	UTSW	7	16563418	missense	probably benign	0.31
R9667:Arhgap35	UTSW	7	16562989	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- GATGTGCTTCAGAATGAGGGC -3'
(R):5'- GTATGAGACCCACTTGGAGAAGC -3'

Sequencing Primer
(F):5'- TGCTTCAGAATGAGGGCATCAC -3'
(R):5'- CCCACTTGGAGAAGCTGAGG -3'

Posted On

2015-03-18