Incidental Mutation 'R3745:Prdm10'
ID271167
Institutional Source Beutler Lab
Gene Symbol Prdm10
Ensembl Gene ENSMUSG00000042496
Gene NamePR domain containing 10
Synonymstristanin, LOC382066
MMRRC Submission 040731-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3745 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location31280538-31381723 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 31340407 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 357 (I357T)
Ref Sequence ENSEMBL: ENSMUSP00000074104 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074510] [ENSMUST00000215499] [ENSMUST00000215847]
Predicted Effect possibly damaging
Transcript: ENSMUST00000074510
AA Change: I357T

PolyPhen 2 Score 0.716 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000074104
Gene: ENSMUSG00000042496
AA Change: I357T

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
low complexity region 111 117 N/A INTRINSIC
PDB:3IHX|D 133 284 1e-104 PDB
Blast:SET 165 277 3e-32 BLAST
ZnF_C2H2 300 322 5.42e-2 SMART
Pfam:Tristanin_u2 325 455 2.4e-49 PFAM
ZnF_C2H2 471 493 7.78e-3 SMART
ZnF_C2H2 501 523 1.95e-3 SMART
ZnF_C2H2 529 551 3.83e-2 SMART
ZnF_C2H2 557 580 8.34e-3 SMART
ZnF_C2H2 585 607 3.21e-4 SMART
ZnF_C2H2 613 636 3.69e-4 SMART
ZnF_C2H2 668 691 8.22e-2 SMART
ZnF_C2H2 801 824 1.25e-1 SMART
low complexity region 904 916 N/A INTRINSIC
low complexity region 956 964 N/A INTRINSIC
low complexity region 988 1007 N/A INTRINSIC
low complexity region 1110 1122 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000215499
AA Change: I388T

PolyPhen 2 Score 0.336 (Sensitivity: 0.90; Specificity: 0.89)
Predicted Effect possibly damaging
Transcript: ENSMUST00000215847
AA Change: I406T

PolyPhen 2 Score 0.478 (Sensitivity: 0.89; Specificity: 0.90)
Meta Mutation Damage Score 0.1349 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 98% (44/45)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a transcription factor that contains C2H2-type zinc-fingers. It also contains a positive regulatory domain, which has been found in several other zinc-finger transcription factors including those involved in B cell differentiation and tumor suppression. Studies of the mouse counterpart suggest that this protein may be involved in the development of the central nerve system (CNS), as well as in the pathogenesis of neuronal storage disease. Multiple alternatively spliced transcript variants encoding distinct isoforms have been observed. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012B07Rik G T 11: 109,794,154 C172* probably null Het
Acot9 G A X: 155,271,945 probably benign Het
Akap10 A G 11: 61,915,305 V199A probably benign Het
Aox4 C T 1: 58,245,870 H594Y probably damaging Het
Arhgap35 A T 7: 16,563,722 Y473N probably damaging Het
Aspn G A 13: 49,566,560 E351K probably damaging Het
Astn1 G T 1: 158,502,060 A162S probably damaging Het
Auts2 A G 5: 131,476,587 probably benign Het
Cog6 A T 3: 52,992,819 M507K probably benign Het
Crct1 C A 3: 93,014,707 probably benign Het
Cyp2d11 A C 15: 82,391,855 I175S probably benign Het
Dclk1 A G 3: 55,247,442 N98D possibly damaging Het
Erich5 T A 15: 34,470,732 C36S probably damaging Het
F5 A G 1: 164,186,779 I540V possibly damaging Het
Fam20a A T 11: 109,677,790 S303R probably benign Het
Fam214a T C 9: 75,009,862 V581A probably benign Het
Fat3 G A 9: 15,998,271 S2145F probably damaging Het
Gbp9 C A 5: 105,105,858 probably benign Het
Gm6408 G T 5: 146,484,436 V292F probably damaging Het
Kmt2a A G 9: 44,831,340 probably benign Het
Lrriq1 T C 10: 103,170,856 D1136G probably damaging Het
Macrod2 C A 2: 141,810,629 T204K probably damaging Het
Mlkl A G 8: 111,315,567 probably benign Het
Msantd1 T A 5: 34,923,467 V155E possibly damaging Het
Myo3b A G 2: 70,234,485 probably benign Het
Nbn T A 4: 15,976,163 C375S possibly damaging Het
Nell2 A C 15: 95,432,673 C231W probably damaging Het
Nipbl A G 15: 8,358,874 S421P probably benign Het
Npr3 A T 15: 11,905,491 V50E probably damaging Het
Olfr1425 A G 19: 12,074,380 L84P probably damaging Het
Pclo T C 5: 14,678,421 probably benign Het
Pkn3 A G 2: 30,090,341 K785R probably damaging Het
Ppef2 T A 5: 92,239,151 probably benign Het
Prrc2c G A 1: 162,698,185 T284I unknown Het
Psma3 T C 12: 70,978,748 S13P possibly damaging Het
Ptch1 T G 13: 63,524,959 E944A probably benign Het
Rpl6l T C 10: 111,126,365 noncoding transcript Het
Tex11 A G X: 100,916,572 V522A probably benign Het
Thsd7b A G 1: 129,678,241 E573G probably benign Het
Tom1l1 A G 11: 90,657,741 S259P probably benign Het
Trpm8 A G 1: 88,348,327 E549G probably benign Het
Vmn1r66 C T 7: 10,274,321 A262T possibly damaging Het
Zc3h13 T A 14: 75,330,661 D1131E probably benign Het
Zfp445 A C 9: 122,854,726 D289E probably benign Het
Other mutations in Prdm10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Prdm10 APN 9 31360812 splice site probably benign
IGL00485:Prdm10 APN 9 31327546 missense possibly damaging 0.87
IGL00757:Prdm10 APN 9 31318546 missense possibly damaging 0.69
IGL00836:Prdm10 APN 9 31329869 splice site probably benign
IGL01505:Prdm10 APN 9 31327282 missense probably benign
IGL01594:Prdm10 APN 9 31346853 missense probably damaging 1.00
IGL01894:Prdm10 APN 9 31316261 missense probably damaging 1.00
IGL01927:Prdm10 APN 9 31335398 splice site probably benign
IGL02053:Prdm10 APN 9 31360848 missense probably benign 0.00
IGL02068:Prdm10 APN 9 31337350 missense probably damaging 1.00
IGL02295:Prdm10 APN 9 31362368 missense probably benign
IGL02390:Prdm10 APN 9 31353389 missense possibly damaging 0.68
IGL02574:Prdm10 APN 9 31357293 missense probably damaging 1.00
IGL02636:Prdm10 APN 9 31329681 missense possibly damaging 0.68
IGL02883:Prdm10 APN 9 31327348 missense probably damaging 0.99
IGL03057:Prdm10 APN 9 31349185 missense probably damaging 1.00
PIT4142001:Prdm10 UTSW 9 31325767 missense probably benign 0.00
R0089:Prdm10 UTSW 9 31316230 missense probably damaging 1.00
R0149:Prdm10 UTSW 9 31316159 splice site probably benign
R0306:Prdm10 UTSW 9 31316224 missense probably damaging 1.00
R0386:Prdm10 UTSW 9 31316300 missense probably damaging 1.00
R0390:Prdm10 UTSW 9 31349268 critical splice donor site probably null
R1512:Prdm10 UTSW 9 31337401 missense probably damaging 1.00
R1528:Prdm10 UTSW 9 31357286 missense probably damaging 1.00
R2409:Prdm10 UTSW 9 31349122 missense possibly damaging 0.81
R3929:Prdm10 UTSW 9 31347136 missense probably damaging 1.00
R4295:Prdm10 UTSW 9 31316294 missense possibly damaging 0.94
R4629:Prdm10 UTSW 9 31337316 nonsense probably null
R4660:Prdm10 UTSW 9 31327328 missense probably damaging 1.00
R4758:Prdm10 UTSW 9 31362412 missense probably benign 0.00
R4793:Prdm10 UTSW 9 31353405 missense probably damaging 1.00
R4798:Prdm10 UTSW 9 31341273 missense probably damaging 1.00
R4806:Prdm10 UTSW 9 31329941 makesense probably null
R4865:Prdm10 UTSW 9 31347080 missense probably damaging 1.00
R5068:Prdm10 UTSW 9 31359047 missense probably damaging 0.96
R5093:Prdm10 UTSW 9 31341483 missense probably damaging 1.00
R5162:Prdm10 UTSW 9 31340418 missense possibly damaging 0.90
R5656:Prdm10 UTSW 9 31353417 missense probably benign 0.08
R5855:Prdm10 UTSW 9 31337323 missense probably damaging 1.00
R6242:Prdm10 UTSW 9 31341252 missense possibly damaging 0.67
R6396:Prdm10 UTSW 9 31318546 missense possibly damaging 0.69
R6970:Prdm10 UTSW 9 31329823 nonsense probably null
R7165:Prdm10 UTSW 9 31316442 splice site probably null
R7177:Prdm10 UTSW 9 31367707 missense probably benign
R7201:Prdm10 UTSW 9 31316306 missense possibly damaging 0.87
R7313:Prdm10 UTSW 9 31357160 nonsense probably null
R7337:Prdm10 UTSW 9 31316241 missense probably damaging 1.00
R7511:Prdm10 UTSW 9 31378481 missense probably damaging 1.00
R7711:Prdm10 UTSW 9 31357232 missense probably damaging 1.00
R7855:Prdm10 UTSW 9 31327474 missense probably benign 0.04
R7965:Prdm10 UTSW 9 31347006 missense probably damaging 1.00
R7997:Prdm10 UTSW 9 31353425 missense probably damaging 1.00
R8168:Prdm10 UTSW 9 31346967 missense probably benign 0.00
R8717:Prdm10 UTSW 9 31341399 missense probably benign 0.31
R8865:Prdm10 UTSW 9 31327397 missense probably damaging 1.00
R8880:Prdm10 UTSW 9 31353446 missense probably damaging 1.00
RF004:Prdm10 UTSW 9 31359126 missense probably damaging 1.00
X0064:Prdm10 UTSW 9 31362451 missense probably damaging 1.00
Z1176:Prdm10 UTSW 9 31316168 missense possibly damaging 0.95
Z1176:Prdm10 UTSW 9 31316293 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGTGCTATAGAGAAACGCTGGG -3'
(R):5'- TTGAAAACGTGCCTTTGTCTTGTTC -3'

Sequencing Primer
(F):5'- CGCTGGGTAGTATAGAAAGCAC -3'
(R):5'- CCAATCCCGCTTTAGTTACCAGG -3'
Posted On2015-03-18