Mutagenetix > Incidental Mutation

Incidental Mutation 'R3745:Prdm10'

271167

Institutional Source

Beutler Lab

Gene Symbol

Prdm10

Ensembl Gene

ENSMUSG00000042496

Gene Name

PR domain containing 10

Synonyms

tristanin, LOC382066

MMRRC Submission

040731-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R3745 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

31280538-31381723 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 31340407 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Threonine at position 357 (I357T)

Ref Sequence

ENSEMBL: ENSMUSP00000074104 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000074510] [ENSMUST00000215499] [ENSMUST00000215847]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000074510
AA Change: I357T

PolyPhen 2 Score 0.716 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000074104
Gene: ENSMUSG00000042496
AA Change: I357T

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
low complexity region	111	117	N/A	INTRINSIC
PDB:3IHX\|D	133	284	1e-104	PDB
Blast:SET	165	277	3e-32	BLAST
ZnF_C2H2	300	322	5.42e-2	SMART
Pfam:Tristanin_u2	325	455	2.4e-49	PFAM
ZnF_C2H2	471	493	7.78e-3	SMART
ZnF_C2H2	501	523	1.95e-3	SMART
ZnF_C2H2	529	551	3.83e-2	SMART
ZnF_C2H2	557	580	8.34e-3	SMART
ZnF_C2H2	585	607	3.21e-4	SMART
ZnF_C2H2	613	636	3.69e-4	SMART
ZnF_C2H2	668	691	8.22e-2	SMART
ZnF_C2H2	801	824	1.25e-1	SMART
low complexity region	904	916	N/A	INTRINSIC
low complexity region	956	964	N/A	INTRINSIC
low complexity region	988	1007	N/A	INTRINSIC
low complexity region	1110	1122	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000215499
AA Change: I388T

PolyPhen 2 Score 0.336 (Sensitivity: 0.90; Specificity: 0.89)

Predicted Effect

possibly damaging
Transcript: ENSMUST00000215847
AA Change: I406T

PolyPhen 2 Score 0.478 (Sensitivity: 0.89; Specificity: 0.90)

Meta Mutation Damage Score

0.1349

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 94.8%

Validation Efficiency

98% (44/45)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a transcription factor that contains C2H2-type zinc-fingers. It also contains a positive regulatory domain, which has been found in several other zinc-finger transcription factors including those involved in B cell differentiation and tumor suppression. Studies of the mouse counterpart suggest that this protein may be involved in the development of the central nerve system (CNS), as well as in the pathogenesis of neuronal storage disease. Multiple alternatively spliced transcript variants encoding distinct isoforms have been observed. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 44 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700012B07Rik	G	T	11: 109,794,154	C172*	probably null	Het
Acot9	G	A	X: 155,271,945		probably benign	Het
Akap10	A	G	11: 61,915,305	V199A	probably benign	Het
Aox4	C	T	1: 58,245,870	H594Y	probably damaging	Het
Arhgap35	A	T	7: 16,563,722	Y473N	probably damaging	Het
Aspn	G	A	13: 49,566,560	E351K	probably damaging	Het
Astn1	G	T	1: 158,502,060	A162S	probably damaging	Het
Auts2	A	G	5: 131,476,587		probably benign	Het
Cog6	A	T	3: 52,992,819	M507K	probably benign	Het
Crct1	C	A	3: 93,014,707		probably benign	Het
Cyp2d11	A	C	15: 82,391,855	I175S	probably benign	Het
Dclk1	A	G	3: 55,247,442	N98D	possibly damaging	Het
Erich5	T	A	15: 34,470,732	C36S	probably damaging	Het
F5	A	G	1: 164,186,779	I540V	possibly damaging	Het
Fam20a	A	T	11: 109,677,790	S303R	probably benign	Het
Fam214a	T	C	9: 75,009,862	V581A	probably benign	Het
Fat3	G	A	9: 15,998,271	S2145F	probably damaging	Het
Gbp9	C	A	5: 105,105,858		probably benign	Het
Gm6408	G	T	5: 146,484,436	V292F	probably damaging	Het
Kmt2a	A	G	9: 44,831,340		probably benign	Het
Lrriq1	T	C	10: 103,170,856	D1136G	probably damaging	Het
Macrod2	C	A	2: 141,810,629	T204K	probably damaging	Het
Mlkl	A	G	8: 111,315,567		probably benign	Het
Msantd1	T	A	5: 34,923,467	V155E	possibly damaging	Het
Myo3b	A	G	2: 70,234,485		probably benign	Het
Nbn	T	A	4: 15,976,163	C375S	possibly damaging	Het
Nell2	A	C	15: 95,432,673	C231W	probably damaging	Het
Nipbl	A	G	15: 8,358,874	S421P	probably benign	Het
Npr3	A	T	15: 11,905,491	V50E	probably damaging	Het
Olfr1425	A	G	19: 12,074,380	L84P	probably damaging	Het
Pclo	T	C	5: 14,678,421		probably benign	Het
Pkn3	A	G	2: 30,090,341	K785R	probably damaging	Het
Ppef2	T	A	5: 92,239,151		probably benign	Het
Prrc2c	G	A	1: 162,698,185	T284I	unknown	Het
Psma3	T	C	12: 70,978,748	S13P	possibly damaging	Het
Ptch1	T	G	13: 63,524,959	E944A	probably benign	Het
Rpl6l	T	C	10: 111,126,365		noncoding transcript	Het
Tex11	A	G	X: 100,916,572	V522A	probably benign	Het
Thsd7b	A	G	1: 129,678,241	E573G	probably benign	Het
Tom1l1	A	G	11: 90,657,741	S259P	probably benign	Het
Trpm8	A	G	1: 88,348,327	E549G	probably benign	Het
Vmn1r66	C	T	7: 10,274,321	A262T	possibly damaging	Het
Zc3h13	T	A	14: 75,330,661	D1131E	probably benign	Het
Zfp445	A	C	9: 122,854,726	D289E	probably benign	Het

Other mutations in Prdm10

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00087:Prdm10	APN	9	31360812	splice site	probably benign
IGL00485:Prdm10	APN	9	31327546	missense	possibly damaging	0.87
IGL00757:Prdm10	APN	9	31318546	missense	possibly damaging	0.69
IGL00836:Prdm10	APN	9	31329869	splice site	probably benign
IGL01505:Prdm10	APN	9	31327282	missense	probably benign
IGL01594:Prdm10	APN	9	31346853	missense	probably damaging	1.00
IGL01894:Prdm10	APN	9	31316261	missense	probably damaging	1.00
IGL01927:Prdm10	APN	9	31335398	splice site	probably benign
IGL02053:Prdm10	APN	9	31360848	missense	probably benign	0.00
IGL02068:Prdm10	APN	9	31337350	missense	probably damaging	1.00
IGL02295:Prdm10	APN	9	31362368	missense	probably benign
IGL02390:Prdm10	APN	9	31353389	missense	possibly damaging	0.68
IGL02574:Prdm10	APN	9	31357293	missense	probably damaging	1.00
IGL02636:Prdm10	APN	9	31329681	missense	possibly damaging	0.68
IGL02883:Prdm10	APN	9	31327348	missense	probably damaging	0.99
IGL03057:Prdm10	APN	9	31349185	missense	probably damaging	1.00
PIT4142001:Prdm10	UTSW	9	31325767	missense	probably benign	0.00
R0089:Prdm10	UTSW	9	31316230	missense	probably damaging	1.00
R0149:Prdm10	UTSW	9	31316159	splice site	probably benign
R0306:Prdm10	UTSW	9	31316224	missense	probably damaging	1.00
R0386:Prdm10	UTSW	9	31316300	missense	probably damaging	1.00
R0390:Prdm10	UTSW	9	31349268	critical splice donor site	probably null
R1512:Prdm10	UTSW	9	31337401	missense	probably damaging	1.00
R1528:Prdm10	UTSW	9	31357286	missense	probably damaging	1.00
R2409:Prdm10	UTSW	9	31349122	missense	possibly damaging	0.81
R3929:Prdm10	UTSW	9	31347136	missense	probably damaging	1.00
R4295:Prdm10	UTSW	9	31316294	missense	possibly damaging	0.94
R4629:Prdm10	UTSW	9	31337316	nonsense	probably null
R4660:Prdm10	UTSW	9	31327328	missense	probably damaging	1.00
R4758:Prdm10	UTSW	9	31362412	missense	probably benign	0.00
R4793:Prdm10	UTSW	9	31353405	missense	probably damaging	1.00
R4798:Prdm10	UTSW	9	31341273	missense	probably damaging	1.00
R4806:Prdm10	UTSW	9	31329941	makesense	probably null
R4865:Prdm10	UTSW	9	31347080	missense	probably damaging	1.00
R5068:Prdm10	UTSW	9	31359047	missense	probably damaging	0.96
R5093:Prdm10	UTSW	9	31341483	missense	probably damaging	1.00
R5162:Prdm10	UTSW	9	31340418	missense	possibly damaging	0.90
R5656:Prdm10	UTSW	9	31353417	missense	probably benign	0.08
R5855:Prdm10	UTSW	9	31337323	missense	probably damaging	1.00
R6242:Prdm10	UTSW	9	31341252	missense	possibly damaging	0.67
R6396:Prdm10	UTSW	9	31318546	missense	possibly damaging	0.69
R6970:Prdm10	UTSW	9	31329823	nonsense	probably null
R7165:Prdm10	UTSW	9	31316442	splice site	probably null
R7177:Prdm10	UTSW	9	31367707	missense	probably benign
R7201:Prdm10	UTSW	9	31316306	missense	possibly damaging	0.87
R7313:Prdm10	UTSW	9	31357160	nonsense	probably null
R7337:Prdm10	UTSW	9	31316241	missense	probably damaging	1.00
R7511:Prdm10	UTSW	9	31378481	missense	probably damaging	1.00
R7711:Prdm10	UTSW	9	31357232	missense	probably damaging	1.00
R7855:Prdm10	UTSW	9	31327474	missense	probably benign	0.04
R7965:Prdm10	UTSW	9	31347006	missense	probably damaging	1.00
R7997:Prdm10	UTSW	9	31353425	missense	probably damaging	1.00
R8168:Prdm10	UTSW	9	31346967	missense	probably benign	0.00
R8717:Prdm10	UTSW	9	31341399	missense	probably benign	0.31
R8865:Prdm10	UTSW	9	31327397	missense	probably damaging	1.00
R8880:Prdm10	UTSW	9	31353446	missense	probably damaging	1.00
R9022:Prdm10	UTSW	9	31357128	missense	probably benign	0.01
R9200:Prdm10	UTSW	9	31357142	missense	probably damaging	1.00
R9288:Prdm10	UTSW	9	31341378	missense	possibly damaging	0.67
R9607:Prdm10	UTSW	9	31349190	missense	probably damaging	1.00
RF004:Prdm10	UTSW	9	31359126	missense	probably damaging	1.00
X0064:Prdm10	UTSW	9	31362451	missense	probably damaging	1.00
Z1176:Prdm10	UTSW	9	31316168	missense	possibly damaging	0.95
Z1176:Prdm10	UTSW	9	31316293	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- TGTGCTATAGAGAAACGCTGGG -3'
(R):5'- TTGAAAACGTGCCTTTGTCTTGTTC -3'

Sequencing Primer
(F):5'- CGCTGGGTAGTATAGAAAGCAC -3'
(R):5'- CCAATCCCGCTTTAGTTACCAGG -3'

Posted On

2015-03-18