Incidental Mutation 'R3745:Fam214a'
ID271170
Institutional Source Beutler Lab
Gene Symbol Fam214a
Ensembl Gene ENSMUSG00000034858
Gene Namefamily with sequence similarity 214, member A
SynonymsBC031353, C130047D21Rik, 6330415I01Rik
MMRRC Submission 040731-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.296) question?
Stock #R3745 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location74952884-75032468 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 75009862 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 581 (V581A)
Ref Sequence ENSEMBL: ENSMUSP00000150065 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081746] [ENSMUST00000170846] [ENSMUST00000214755] [ENSMUST00000215370]
Predicted Effect probably benign
Transcript: ENSMUST00000081746
AA Change: V588A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000080442
Gene: ENSMUSG00000034858
AA Change: V588A

DomainStartEndE-ValueType
low complexity region 349 360 N/A INTRINSIC
internal_repeat_1 361 458 7.22e-14 PROSPERO
internal_repeat_1 473 570 7.22e-14 PROSPERO
low complexity region 840 859 N/A INTRINSIC
DUF4210 885 943 8.5e-29 SMART
Pfam:Chromosome_seg 1024 1081 3.5e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000170846
AA Change: V581A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000129319
Gene: ENSMUSG00000034858
AA Change: V581A

DomainStartEndE-ValueType
low complexity region 342 353 N/A INTRINSIC
internal_repeat_1 354 451 8.38e-14 PROSPERO
internal_repeat_1 466 563 8.38e-14 PROSPERO
low complexity region 833 852 N/A INTRINSIC
DUF4210 878 936 8.5e-29 SMART
Pfam:Chromosome_seg 1016 1074 1.8e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000214755
AA Change: V581A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Predicted Effect probably benign
Transcript: ENSMUST00000215370
AA Change: V581A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 98% (44/45)
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012B07Rik G T 11: 109,794,154 C172* probably null Het
Acot9 G A X: 155,271,945 probably benign Het
Akap10 A G 11: 61,915,305 V199A probably benign Het
Aox4 C T 1: 58,245,870 H594Y probably damaging Het
Arhgap35 A T 7: 16,563,722 Y473N probably damaging Het
Aspn G A 13: 49,566,560 E351K probably damaging Het
Astn1 G T 1: 158,502,060 A162S probably damaging Het
Auts2 A G 5: 131,476,587 probably benign Het
Cog6 A T 3: 52,992,819 M507K probably benign Het
Crct1 C A 3: 93,014,707 probably benign Het
Cyp2d11 A C 15: 82,391,855 I175S probably benign Het
Dclk1 A G 3: 55,247,442 N98D possibly damaging Het
Erich5 T A 15: 34,470,732 C36S probably damaging Het
F5 A G 1: 164,186,779 I540V possibly damaging Het
Fam20a A T 11: 109,677,790 S303R probably benign Het
Fat3 G A 9: 15,998,271 S2145F probably damaging Het
Gbp9 C A 5: 105,105,858 probably benign Het
Gm6408 G T 5: 146,484,436 V292F probably damaging Het
Kmt2a A G 9: 44,831,340 probably benign Het
Lrriq1 T C 10: 103,170,856 D1136G probably damaging Het
Macrod2 C A 2: 141,810,629 T204K probably damaging Het
Mlkl A G 8: 111,315,567 probably benign Het
Msantd1 T A 5: 34,923,467 V155E possibly damaging Het
Myo3b A G 2: 70,234,485 probably benign Het
Nbn T A 4: 15,976,163 C375S possibly damaging Het
Nell2 A C 15: 95,432,673 C231W probably damaging Het
Nipbl A G 15: 8,358,874 S421P probably benign Het
Npr3 A T 15: 11,905,491 V50E probably damaging Het
Olfr1425 A G 19: 12,074,380 L84P probably damaging Het
Pclo T C 5: 14,678,421 probably benign Het
Pkn3 A G 2: 30,090,341 K785R probably damaging Het
Ppef2 T A 5: 92,239,151 probably benign Het
Prdm10 T C 9: 31,340,407 I357T possibly damaging Het
Prrc2c G A 1: 162,698,185 T284I unknown Het
Psma3 T C 12: 70,978,748 S13P possibly damaging Het
Ptch1 T G 13: 63,524,959 E944A probably benign Het
Rpl6l T C 10: 111,126,365 noncoding transcript Het
Tex11 A G X: 100,916,572 V522A probably benign Het
Thsd7b A G 1: 129,678,241 E573G probably benign Het
Tom1l1 A G 11: 90,657,741 S259P probably benign Het
Trpm8 A G 1: 88,348,327 E549G probably benign Het
Vmn1r66 C T 7: 10,274,321 A262T possibly damaging Het
Zc3h13 T A 14: 75,330,661 D1131E probably benign Het
Zfp445 A C 9: 122,854,726 D289E probably benign Het
Other mutations in Fam214a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00333:Fam214a APN 9 75025790 missense probably benign 0.28
IGL00588:Fam214a APN 9 75009581 missense probably damaging 1.00
IGL01887:Fam214a APN 9 75017057 missense probably benign 0.39
IGL02828:Fam214a APN 9 75006432 missense probably damaging 1.00
IGL03060:Fam214a APN 9 75010168 missense probably damaging 0.96
IGL03277:Fam214a APN 9 75009232 missense probably damaging 1.00
R0052:Fam214a UTSW 9 75018983 splice site probably benign
R0052:Fam214a UTSW 9 75018983 splice site probably benign
R0615:Fam214a UTSW 9 75004288 missense probably damaging 1.00
R0723:Fam214a UTSW 9 75009451 missense probably damaging 1.00
R1428:Fam214a UTSW 9 75006321 missense probably benign 0.07
R1448:Fam214a UTSW 9 75010174 nonsense probably null
R1656:Fam214a UTSW 9 75008959 missense probably benign 0.00
R2024:Fam214a UTSW 9 75010390 missense probably damaging 0.98
R3147:Fam214a UTSW 9 75008838 missense probably benign 0.25
R4105:Fam214a UTSW 9 75008776 missense probably damaging 1.00
R4224:Fam214a UTSW 9 75008726 missense probably damaging 1.00
R4496:Fam214a UTSW 9 75031531 missense probably damaging 0.99
R4519:Fam214a UTSW 9 75023647 missense probably damaging 1.00
R4715:Fam214a UTSW 9 75012968 missense probably damaging 1.00
R4885:Fam214a UTSW 9 75006367 missense probably damaging 1.00
R5009:Fam214a UTSW 9 75008889 missense probably damaging 0.98
R5574:Fam214a UTSW 9 75010390 missense probably damaging 1.00
R5645:Fam214a UTSW 9 75025679 missense probably damaging 1.00
R5696:Fam214a UTSW 9 75010117 missense probably benign 0.01
R5891:Fam214a UTSW 9 75004386 missense probably damaging 1.00
R5936:Fam214a UTSW 9 75009304 missense probably benign 0.00
R6165:Fam214a UTSW 9 75025672 missense probably damaging 0.96
R6228:Fam214a UTSW 9 75006363 missense possibly damaging 0.94
R6419:Fam214a UTSW 9 75009337 missense probably benign 0.20
R6499:Fam214a UTSW 9 75023648 missense probably damaging 1.00
R6631:Fam214a UTSW 9 74953825 missense possibly damaging 0.71
R6649:Fam214a UTSW 9 75010150 missense probably damaging 0.96
R6849:Fam214a UTSW 9 75009312 missense probably damaging 0.96
R7189:Fam214a UTSW 9 75004351 missense probably damaging 0.99
R7402:Fam214a UTSW 9 75006386 nonsense probably null
R8691:Fam214a UTSW 9 75010053 missense probably benign 0.09
R8769:Fam214a UTSW 9 75025825 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCATTCAGCAAGCACGACTC -3'
(R):5'- TGCAATGCAAACACTGTTTCTCAG -3'

Sequencing Primer
(F):5'- CCATTCCTTCTAAAGTGTTCAGGAG -3'
(R):5'- ATGGCTCATTTCTTGCTCCTTAAG -3'
Posted On2015-03-18