Incidental Mutation 'R3745:Zfp445'
ID271171
Institutional Source Beutler Lab
Gene Symbol Zfp445
Ensembl Gene ENSMUSG00000047036
Gene Namezinc finger protein 445
SynonymsZNF168
MMRRC Submission 040731-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.734) question?
Stock #R3745 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location122844529-122866006 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 122854726 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 289 (D289E)
Ref Sequence ENSEMBL: ENSMUSP00000148942 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056467] [ENSMUST00000213971] [ENSMUST00000214626] [ENSMUST00000216063]
Predicted Effect probably benign
Transcript: ENSMUST00000056467
AA Change: D289E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000055738
Gene: ENSMUSG00000047036
AA Change: D289E

DomainStartEndE-ValueType
SCAN 48 160 1.07e-59 SMART
KRAB 219 278 6.74e-30 SMART
low complexity region 320 334 N/A INTRINSIC
low complexity region 419 430 N/A INTRINSIC
ZnF_C2H2 470 492 2.09e-3 SMART
ZnF_C2H2 498 520 3.16e-3 SMART
ZnF_C2H2 553 575 1.41e0 SMART
ZnF_C2H2 581 603 1.04e-3 SMART
ZnF_C2H2 634 656 1.6e-4 SMART
ZnF_C2H2 662 686 6.78e-3 SMART
ZnF_C2H2 718 740 1.67e-2 SMART
ZnF_C2H2 746 768 1.2e-3 SMART
ZnF_C2H2 796 818 2.02e-1 SMART
ZnF_C2H2 824 846 2.95e-3 SMART
ZnF_C2H2 933 955 2.49e-1 SMART
ZnF_C2H2 961 983 4.61e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000213971
AA Change: D115E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214162
Predicted Effect probably benign
Transcript: ENSMUST00000214626
AA Change: D289E

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Predicted Effect probably benign
Transcript: ENSMUST00000216063
AA Change: D289E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216243
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 98% (44/45)
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012B07Rik G T 11: 109,794,154 C172* probably null Het
Acot9 G A X: 155,271,945 probably benign Het
Akap10 A G 11: 61,915,305 V199A probably benign Het
Aox4 C T 1: 58,245,870 H594Y probably damaging Het
Arhgap35 A T 7: 16,563,722 Y473N probably damaging Het
Aspn G A 13: 49,566,560 E351K probably damaging Het
Astn1 G T 1: 158,502,060 A162S probably damaging Het
Auts2 A G 5: 131,476,587 probably benign Het
Cog6 A T 3: 52,992,819 M507K probably benign Het
Crct1 C A 3: 93,014,707 probably benign Het
Cyp2d11 A C 15: 82,391,855 I175S probably benign Het
Dclk1 A G 3: 55,247,442 N98D possibly damaging Het
Erich5 T A 15: 34,470,732 C36S probably damaging Het
F5 A G 1: 164,186,779 I540V possibly damaging Het
Fam20a A T 11: 109,677,790 S303R probably benign Het
Fam214a T C 9: 75,009,862 V581A probably benign Het
Fat3 G A 9: 15,998,271 S2145F probably damaging Het
Gbp9 C A 5: 105,105,858 probably benign Het
Gm6408 G T 5: 146,484,436 V292F probably damaging Het
Kmt2a A G 9: 44,831,340 probably benign Het
Lrriq1 T C 10: 103,170,856 D1136G probably damaging Het
Macrod2 C A 2: 141,810,629 T204K probably damaging Het
Mlkl A G 8: 111,315,567 probably benign Het
Msantd1 T A 5: 34,923,467 V155E possibly damaging Het
Myo3b A G 2: 70,234,485 probably benign Het
Nbn T A 4: 15,976,163 C375S possibly damaging Het
Nell2 A C 15: 95,432,673 C231W probably damaging Het
Nipbl A G 15: 8,358,874 S421P probably benign Het
Npr3 A T 15: 11,905,491 V50E probably damaging Het
Olfr1425 A G 19: 12,074,380 L84P probably damaging Het
Pclo T C 5: 14,678,421 probably benign Het
Pkn3 A G 2: 30,090,341 K785R probably damaging Het
Ppef2 T A 5: 92,239,151 probably benign Het
Prdm10 T C 9: 31,340,407 I357T possibly damaging Het
Prrc2c G A 1: 162,698,185 T284I unknown Het
Psma3 T C 12: 70,978,748 S13P possibly damaging Het
Ptch1 T G 13: 63,524,959 E944A probably benign Het
Rpl6l T C 10: 111,126,365 noncoding transcript Het
Tex11 A G X: 100,916,572 V522A probably benign Het
Thsd7b A G 1: 129,678,241 E573G probably benign Het
Tom1l1 A G 11: 90,657,741 S259P probably benign Het
Trpm8 A G 1: 88,348,327 E549G probably benign Het
Vmn1r66 C T 7: 10,274,321 A262T possibly damaging Het
Zc3h13 T A 14: 75,330,661 D1131E probably benign Het
Other mutations in Zfp445
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02427:Zfp445 APN 9 122852230 missense probably benign 0.02
IGL02608:Zfp445 APN 9 122861875 missense probably damaging 0.98
IGL03216:Zfp445 APN 9 122851978 missense probably damaging 0.99
IGL03218:Zfp445 APN 9 122857529 missense probably benign 0.00
Nonpareil UTSW 9 122852345 missense probably benign 0.02
R0080:Zfp445 UTSW 9 122852356 missense probably damaging 0.98
R0082:Zfp445 UTSW 9 122852356 missense probably damaging 0.98
R0453:Zfp445 UTSW 9 122853513 missense possibly damaging 0.92
R0610:Zfp445 UTSW 9 122852981 missense probably benign 0.44
R0730:Zfp445 UTSW 9 122861758 missense probably damaging 1.00
R1622:Zfp445 UTSW 9 122852549 missense possibly damaging 0.90
R1719:Zfp445 UTSW 9 122852642 missense probably damaging 1.00
R2108:Zfp445 UTSW 9 122852240 missense probably benign 0.13
R2117:Zfp445 UTSW 9 122853437 nonsense probably null
R2143:Zfp445 UTSW 9 122853482 missense possibly damaging 0.70
R2162:Zfp445 UTSW 9 122852476 missense probably damaging 0.99
R3620:Zfp445 UTSW 9 122852768 missense probably benign
R3621:Zfp445 UTSW 9 122852768 missense probably benign
R3829:Zfp445 UTSW 9 122853077 missense probably benign
R3831:Zfp445 UTSW 9 122852476 missense probably damaging 0.99
R4172:Zfp445 UTSW 9 122851937 missense probably benign 0.01
R4180:Zfp445 UTSW 9 122852524 missense probably benign 0.00
R4747:Zfp445 UTSW 9 122857150 missense possibly damaging 0.81
R4923:Zfp445 UTSW 9 122852293 missense probably benign
R5010:Zfp445 UTSW 9 122852345 missense probably benign 0.02
R5578:Zfp445 UTSW 9 122853337 missense probably benign 0.00
R5759:Zfp445 UTSW 9 122853146 missense probably benign 0.00
R5864:Zfp445 UTSW 9 122853487 missense probably benign 0.00
R5865:Zfp445 UTSW 9 122853487 missense probably benign 0.00
R5987:Zfp445 UTSW 9 122853886 missense probably benign
R6481:Zfp445 UTSW 9 122857566 missense probably benign 0.00
R6738:Zfp445 UTSW 9 122862058 missense probably damaging 0.96
R6917:Zfp445 UTSW 9 122862294 splice site probably null
R7137:Zfp445 UTSW 9 122854778 missense probably damaging 1.00
R7224:Zfp445 UTSW 9 122852143 missense probably benign 0.28
R8056:Zfp445 UTSW 9 122851967 missense possibly damaging 0.95
R8263:Zfp445 UTSW 9 122852813 missense probably benign 0.00
R8313:Zfp445 UTSW 9 122853630 missense possibly damaging 0.48
R8929:Zfp445 UTSW 9 122853667 missense probably benign 0.11
Predicted Primers PCR Primer
(F):5'- GTGGCCGATTATAAGTCAAGCAG -3'
(R):5'- GCTATCACAAATGGCTGGCC -3'

Sequencing Primer
(F):5'- CAGAAAGTGGCCCAGGGTTC -3'
(R):5'- GCCAGGCATTCTGTCCTAG -3'
Posted On2015-03-18