Incidental Mutation 'R3745:Tom1l1'
ID271176
Institutional Source Beutler Lab
Gene Symbol Tom1l1
Ensembl Gene ENSMUSG00000020541
Gene Nametarget of myb1-like 1 (chicken)
Synonyms2310045L10Rik, Srcasm
MMRRC Submission 040731-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.198) question?
Stock #R3745 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location90643465-90688366 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 90657741 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 259 (S259P)
Ref Sequence ENSEMBL: ENSMUSP00000103501 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020849] [ENSMUST00000107867] [ENSMUST00000107868] [ENSMUST00000107869]
Predicted Effect probably benign
Transcript: ENSMUST00000020849
AA Change: S335P

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000020849
Gene: ENSMUSG00000020541
AA Change: S335P

DomainStartEndE-ValueType
VHS 15 150 7.37e-53 SMART
Pfam:GAT 212 288 5.8e-17 PFAM
low complexity region 340 349 N/A INTRINSIC
low complexity region 409 416 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107867
AA Change: S88P

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000103499
Gene: ENSMUSG00000020541
AA Change: S88P

DomainStartEndE-ValueType
Pfam:GAT 1 50 5.4e-12 PFAM
low complexity region 93 102 N/A INTRINSIC
low complexity region 162 169 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107868
AA Change: S258P

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000103500
Gene: ENSMUSG00000020541
AA Change: S258P

DomainStartEndE-ValueType
Pfam:VHS 1 73 4.2e-10 PFAM
Pfam:GAT 119 220 5.5e-29 PFAM
low complexity region 263 272 N/A INTRINSIC
low complexity region 332 339 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107869
AA Change: S259P

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000103501
Gene: ENSMUSG00000020541
AA Change: S259P

DomainStartEndE-ValueType
VHS 15 152 7.23e-38 SMART
low complexity region 264 273 N/A INTRINSIC
low complexity region 333 340 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147329
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 98% (44/45)
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012B07Rik G T 11: 109,794,154 C172* probably null Het
Acot9 G A X: 155,271,945 probably benign Het
Akap10 A G 11: 61,915,305 V199A probably benign Het
Aox4 C T 1: 58,245,870 H594Y probably damaging Het
Arhgap35 A T 7: 16,563,722 Y473N probably damaging Het
Aspn G A 13: 49,566,560 E351K probably damaging Het
Astn1 G T 1: 158,502,060 A162S probably damaging Het
Auts2 A G 5: 131,476,587 probably benign Het
Cog6 A T 3: 52,992,819 M507K probably benign Het
Crct1 C A 3: 93,014,707 probably benign Het
Cyp2d11 A C 15: 82,391,855 I175S probably benign Het
Dclk1 A G 3: 55,247,442 N98D possibly damaging Het
Erich5 T A 15: 34,470,732 C36S probably damaging Het
F5 A G 1: 164,186,779 I540V possibly damaging Het
Fam20a A T 11: 109,677,790 S303R probably benign Het
Fam214a T C 9: 75,009,862 V581A probably benign Het
Fat3 G A 9: 15,998,271 S2145F probably damaging Het
Gbp9 C A 5: 105,105,858 probably benign Het
Gm6408 G T 5: 146,484,436 V292F probably damaging Het
Kmt2a A G 9: 44,831,340 probably benign Het
Lrriq1 T C 10: 103,170,856 D1136G probably damaging Het
Macrod2 C A 2: 141,810,629 T204K probably damaging Het
Mlkl A G 8: 111,315,567 probably benign Het
Msantd1 T A 5: 34,923,467 V155E possibly damaging Het
Myo3b A G 2: 70,234,485 probably benign Het
Nbn T A 4: 15,976,163 C375S possibly damaging Het
Nell2 A C 15: 95,432,673 C231W probably damaging Het
Nipbl A G 15: 8,358,874 S421P probably benign Het
Npr3 A T 15: 11,905,491 V50E probably damaging Het
Olfr1425 A G 19: 12,074,380 L84P probably damaging Het
Pclo T C 5: 14,678,421 probably benign Het
Pkn3 A G 2: 30,090,341 K785R probably damaging Het
Ppef2 T A 5: 92,239,151 probably benign Het
Prdm10 T C 9: 31,340,407 I357T possibly damaging Het
Prrc2c G A 1: 162,698,185 T284I unknown Het
Psma3 T C 12: 70,978,748 S13P possibly damaging Het
Ptch1 T G 13: 63,524,959 E944A probably benign Het
Rpl6l T C 10: 111,126,365 noncoding transcript Het
Tex11 A G X: 100,916,572 V522A probably benign Het
Thsd7b A G 1: 129,678,241 E573G probably benign Het
Trpm8 A G 1: 88,348,327 E549G probably benign Het
Vmn1r66 C T 7: 10,274,321 A262T possibly damaging Het
Zc3h13 T A 14: 75,330,661 D1131E probably benign Het
Zfp445 A C 9: 122,854,726 D289E probably benign Het
Other mutations in Tom1l1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00595:Tom1l1 APN 11 90674740 missense probably damaging 1.00
IGL01995:Tom1l1 APN 11 90649861 missense probably damaging 0.96
R0057:Tom1l1 UTSW 11 90685149 splice site probably benign
R1557:Tom1l1 UTSW 11 90656384 missense possibly damaging 0.92
R1614:Tom1l1 UTSW 11 90683254 missense probably damaging 1.00
R1616:Tom1l1 UTSW 11 90656351 missense possibly damaging 0.92
R2165:Tom1l1 UTSW 11 90649895 splice site probably benign
R2517:Tom1l1 UTSW 11 90671125 missense possibly damaging 0.66
R4614:Tom1l1 UTSW 11 90671126 missense probably damaging 1.00
R4694:Tom1l1 UTSW 11 90646849 missense possibly damaging 0.86
R4755:Tom1l1 UTSW 11 90685116 missense probably damaging 1.00
R5397:Tom1l1 UTSW 11 90661774 missense probably benign 0.02
R6294:Tom1l1 UTSW 11 90661761 nonsense probably null
R6733:Tom1l1 UTSW 11 90685060 critical splice donor site probably null
R6911:Tom1l1 UTSW 11 90644161 splice site probably null
R7103:Tom1l1 UTSW 11 90671081 splice site probably null
R7489:Tom1l1 UTSW 11 90656359 missense probably benign 0.00
R7696:Tom1l1 UTSW 11 90672915 missense probably benign 0.02
R8244:Tom1l1 UTSW 11 90657821 missense probably benign 0.13
R8787:Tom1l1 UTSW 11 90671105 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TAACCCAACCATGTTGCAGGG -3'
(R):5'- TCCTGTGCTTAGGAGGATGTAC -3'

Sequencing Primer
(F):5'- CATGTTGCAGGGCAGCGATTC -3'
(R):5'- GGCTGAAGTTTGCCTTGAAAAATATG -3'
Posted On2015-03-18