Incidental Mutation 'R3745:Fam20a'
ID 271177
Institutional Source Beutler Lab
Gene Symbol Fam20a
Ensembl Gene ENSMUSG00000020614
Gene Name family with sequence similarity 20, member A
Synonyms
MMRRC Submission 040731-MU
Accession Numbers

Ncbi RefSeq: NM_153782.1; MGI:2388266
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R3745 (G1)
Quality Score 225
Status Validated
Chromosome 11
Chromosomal Location 109669749-109722279 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 109677790 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Arginine at position 303 (S303R)
Ref Sequence ENSEMBL: ENSMUSP00000116687 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020938] [ENSMUST00000155559]
AlphaFold Q8CID3
Predicted Effect probably benign
Transcript: ENSMUST00000020938
AA Change: S303R

PolyPhen 2 Score 0.175 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000020938
Gene: ENSMUSG00000020614
AA Change: S303R

DomainStartEndE-ValueType
transmembrane domain 9 28 N/A INTRINSIC
low complexity region 50 61 N/A INTRINSIC
Pfam:Fam20C 306 522 8.9e-101 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144972
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146408
Predicted Effect probably benign
Transcript: ENSMUST00000155559
AA Change: S303R

PolyPhen 2 Score 0.175 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000116687
Gene: ENSMUSG00000020614
AA Change: S303R

DomainStartEndE-ValueType
transmembrane domain 9 28 N/A INTRINSIC
low complexity region 50 61 N/A INTRINSIC
Pfam:DUF1193 305 525 3.2e-103 PFAM
Meta Mutation Damage Score 0.0742 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 98% (44/45)
MGI Phenotype Strain: 5432376
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This locus encodes a protein that is likely secreted and may function in hematopoiesis. A mutation at this locus has been associated with amelogenesis imperfecta and gingival hyperplasia syndrome. Alternatively spliced transcript variants have been identified. [provided by RefSeq, Aug 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormal ameloblast morphology, disrupted dental enamel formation in both incisor and molar teeth, abnormal kidney morphology, disseminated calcifications of muscular arteries, and intrapulmonary calcifications. [provided by MGI curators]
Allele List at MGI

All alleles(2) : Targeted(2)
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012B07Rik G T 11: 109,794,154 C172* probably null Het
Acot9 G A X: 155,271,945 probably benign Het
Akap10 A G 11: 61,915,305 V199A probably benign Het
Aox4 C T 1: 58,245,870 H594Y probably damaging Het
Arhgap35 A T 7: 16,563,722 Y473N probably damaging Het
Aspn G A 13: 49,566,560 E351K probably damaging Het
Astn1 G T 1: 158,502,060 A162S probably damaging Het
Auts2 A G 5: 131,476,587 probably benign Het
Cog6 A T 3: 52,992,819 M507K probably benign Het
Crct1 C A 3: 93,014,707 probably benign Het
Cyp2d11 A C 15: 82,391,855 I175S probably benign Het
Dclk1 A G 3: 55,247,442 N98D possibly damaging Het
Erich5 T A 15: 34,470,732 C36S probably damaging Het
F5 A G 1: 164,186,779 I540V possibly damaging Het
Fam214a T C 9: 75,009,862 V581A probably benign Het
Fat3 G A 9: 15,998,271 S2145F probably damaging Het
Gbp9 C A 5: 105,105,858 probably benign Het
Gm6408 G T 5: 146,484,436 V292F probably damaging Het
Kmt2a A G 9: 44,831,340 probably benign Het
Lrriq1 T C 10: 103,170,856 D1136G probably damaging Het
Macrod2 C A 2: 141,810,629 T204K probably damaging Het
Mlkl A G 8: 111,315,567 probably benign Het
Msantd1 T A 5: 34,923,467 V155E possibly damaging Het
Myo3b A G 2: 70,234,485 probably benign Het
Nbn T A 4: 15,976,163 C375S possibly damaging Het
Nell2 A C 15: 95,432,673 C231W probably damaging Het
Nipbl A G 15: 8,358,874 S421P probably benign Het
Npr3 A T 15: 11,905,491 V50E probably damaging Het
Olfr1425 A G 19: 12,074,380 L84P probably damaging Het
Pclo T C 5: 14,678,421 probably benign Het
Pkn3 A G 2: 30,090,341 K785R probably damaging Het
Ppef2 T A 5: 92,239,151 probably benign Het
Prdm10 T C 9: 31,340,407 I357T possibly damaging Het
Prrc2c G A 1: 162,698,185 T284I unknown Het
Psma3 T C 12: 70,978,748 S13P possibly damaging Het
Ptch1 T G 13: 63,524,959 E944A probably benign Het
Rpl6l T C 10: 111,126,365 noncoding transcript Het
Tex11 A G X: 100,916,572 V522A probably benign Het
Thsd7b A G 1: 129,678,241 E573G probably benign Het
Tom1l1 A G 11: 90,657,741 S259P probably benign Het
Trpm8 A G 1: 88,348,327 E549G probably benign Het
Vmn1r66 C T 7: 10,274,321 A262T possibly damaging Het
Zc3h13 T A 14: 75,330,661 D1131E probably benign Het
Zfp445 A C 9: 122,854,726 D289E probably benign Het
Other mutations in Fam20a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00827:Fam20a APN 11 109677762 splice site probably benign
IGL01296:Fam20a APN 11 109685351 missense possibly damaging 0.93
IGL01319:Fam20a APN 11 109678458 splice site probably benign
IGL01322:Fam20a APN 11 109682912 missense probably damaging 1.00
IGL02086:Fam20a APN 11 109673413 missense probably benign 0.00
IGL02563:Fam20a APN 11 109677794 missense possibly damaging 0.53
IGL02883:Fam20a APN 11 109675127 missense probably damaging 0.99
IGL02893:Fam20a APN 11 109721588 missense probably benign 0.00
Infamy UTSW 11 109673342 missense possibly damaging 0.87
snide UTSW 11 109721375 missense possibly damaging 0.92
ungainly UTSW 11 109682870 nonsense probably null
P0026:Fam20a UTSW 11 109675841 critical splice donor site probably null
R0726:Fam20a UTSW 11 109677194 missense probably damaging 1.00
R1317:Fam20a UTSW 11 109677838 missense probably damaging 0.99
R1462:Fam20a UTSW 11 109677317 missense probably damaging 1.00
R1462:Fam20a UTSW 11 109677317 missense probably damaging 1.00
R1751:Fam20a UTSW 11 109677838 missense probably damaging 0.99
R1761:Fam20a UTSW 11 109677838 missense probably damaging 0.99
R1889:Fam20a UTSW 11 109673554 missense probably benign 0.30
R1895:Fam20a UTSW 11 109673554 missense probably benign 0.30
R1971:Fam20a UTSW 11 109685411 missense probably damaging 1.00
R2192:Fam20a UTSW 11 109674623 missense probably benign 0.13
R4684:Fam20a UTSW 11 109721687 missense unknown
R4835:Fam20a UTSW 11 109673563 missense probably benign 0.40
R5045:Fam20a UTSW 11 109677885 missense probably benign 0.38
R5161:Fam20a UTSW 11 109673370 missense probably benign 0.00
R5715:Fam20a UTSW 11 109678431 missense probably damaging 1.00
R5817:Fam20a UTSW 11 109673418 missense possibly damaging 0.81
R5960:Fam20a UTSW 11 109675969 intron probably benign
R6162:Fam20a UTSW 11 109682870 nonsense probably null
R6312:Fam20a UTSW 11 109674630 missense probably damaging 1.00
R7231:Fam20a UTSW 11 109721375 missense possibly damaging 0.92
R7311:Fam20a UTSW 11 109674628 nonsense probably null
R7366:Fam20a UTSW 11 109673342 missense possibly damaging 0.87
R8013:Fam20a UTSW 11 109685506 missense possibly damaging 0.92
R8014:Fam20a UTSW 11 109685506 missense possibly damaging 0.92
R9086:Fam20a UTSW 11 109675928 nonsense probably null
R9751:Fam20a UTSW 11 109675166 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGATGTATAATCTCCAGCTCCTG -3'
(R):5'- AAGGAAACATTTGTTGGGCAAC -3'

Sequencing Primer
(F):5'- AGACCATCGTCTCATACAGTTC -3'
(R):5'- GGCAACATTTGTTCCCCAG -3'
Posted On 2015-03-18