Mutagenetix > Incidental Mutations

Incidental Mutation 'R3745:1700012B07Rik'

271178

Institutional Source

Beutler Lab

Gene Symbol

1700012B07Rik

Ensembl Gene

ENSMUSG00000020617

Gene Name

RIKEN cDNA 1700012B07 gene

Synonyms

MMRRC Submission

040731-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.054) question?

Stock #

R3745 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

109787651-109828046 bp(-) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

G to T at 109794154 bp

Zygosity

Heterozygous

Amino Acid Change

Cysteine to Stop codon at position 172 (C172*)

Ref Sequence

ENSEMBL: ENSMUSP00000102285 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000020941] [ENSMUST00000106674] [ENSMUST00000143578]

Predicted Effect

probably null
Transcript: ENSMUST00000020941
AA Change: C172*

SMART Domains

Protein: ENSMUSP00000020941
Gene: ENSMUSG00000020617
AA Change: C172*

Domain	Start	End	E-Value	Type
low complexity region	41	46	N/A	INTRINSIC
low complexity region	61	71	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000106674
AA Change: C172*

SMART Domains

Protein: ENSMUSP00000102285
Gene: ENSMUSG00000020617
AA Change: C172*

Domain	Start	End	E-Value	Type
low complexity region	41	46	N/A	INTRINSIC
low complexity region	61	71	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000143578

SMART Domains

Protein: ENSMUSP00000115395
Gene: ENSMUSG00000020617

Domain	Start	End	E-Value	Type
low complexity region	33	38	N/A	INTRINSIC
low complexity region	53	63	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000147006

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 94.8%

Validation Efficiency

98% (44/45)

Allele List at MGI

Other mutations in this stock

Total: 44 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acot9	G	A	X: 155,271,945		probably benign	Het
Akap10	A	G	11: 61,915,305	V199A	probably benign	Het
Aox4	C	T	1: 58,245,870	H594Y	probably damaging	Het
Arhgap35	A	T	7: 16,563,722	Y473N	probably damaging	Het
Aspn	G	A	13: 49,566,560	E351K	probably damaging	Het
Astn1	G	T	1: 158,502,060	A162S	probably damaging	Het
Auts2	A	G	5: 131,476,587		probably benign	Het
Cog6	A	T	3: 52,992,819	M507K	probably benign	Het
Crct1	C	A	3: 93,014,707		probably benign	Het
Cyp2d11	A	C	15: 82,391,855	I175S	probably benign	Het
Dclk1	A	G	3: 55,247,442	N98D	possibly damaging	Het
Erich5	T	A	15: 34,470,732	C36S	probably damaging	Het
F5	A	G	1: 164,186,779	I540V	possibly damaging	Het
Fam20a	A	T	11: 109,677,790	S303R	probably benign	Het
Fam214a	T	C	9: 75,009,862	V581A	probably benign	Het
Fat3	G	A	9: 15,998,271	S2145F	probably damaging	Het
Gbp9	C	A	5: 105,105,858		probably benign	Het
Gm6408	G	T	5: 146,484,436	V292F	probably damaging	Het
Kmt2a	A	G	9: 44,831,340		probably benign	Het
Lrriq1	T	C	10: 103,170,856	D1136G	probably damaging	Het
Macrod2	C	A	2: 141,810,629	T204K	probably damaging	Het
Mlkl	A	G	8: 111,315,567		probably benign	Het
Msantd1	T	A	5: 34,923,467	V155E	possibly damaging	Het
Myo3b	A	G	2: 70,234,485		probably benign	Het
Nbn	T	A	4: 15,976,163	C375S	possibly damaging	Het
Nell2	A	C	15: 95,432,673	C231W	probably damaging	Het
Nipbl	A	G	15: 8,358,874	S421P	probably benign	Het
Npr3	A	T	15: 11,905,491	V50E	probably damaging	Het
Olfr1425	A	G	19: 12,074,380	L84P	probably damaging	Het
Pclo	T	C	5: 14,678,421		probably benign	Het
Pkn3	A	G	2: 30,090,341	K785R	probably damaging	Het
Ppef2	T	A	5: 92,239,151		probably benign	Het
Prdm10	T	C	9: 31,340,407	I357T	possibly damaging	Het
Prrc2c	G	A	1: 162,698,185	T284I	unknown	Het
Psma3	T	C	12: 70,978,748	S13P	possibly damaging	Het
Ptch1	T	G	13: 63,524,959	E944A	probably benign	Het
Rpl6l	T	C	10: 111,126,365		noncoding transcript	Het
Tex11	A	G	X: 100,916,572	V522A	probably benign	Het
Thsd7b	A	G	1: 129,678,241	E573G	probably benign	Het
Tom1l1	A	G	11: 90,657,741	S259P	probably benign	Het
Trpm8	A	G	1: 88,348,327	E549G	probably benign	Het
Vmn1r66	C	T	7: 10,274,321	A262T	possibly damaging	Het
Zc3h13	T	A	14: 75,330,661	D1131E	probably benign	Het
Zfp445	A	C	9: 122,854,726	D289E	probably benign	Het

Other mutations in 1700012B07Rik

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01916:1700012B07Rik	APN	11	109794111	missense	probably damaging	0.99
IGL03006:1700012B07Rik	APN	11	109827845	missense	probably damaging	0.98
R0626:1700012B07Rik	UTSW	11	109788721	unclassified	probably benign
R1566:1700012B07Rik	UTSW	11	109788806	missense	probably benign	0.01
R1654:1700012B07Rik	UTSW	11	109797399	missense	probably benign	0.36
R2373:1700012B07Rik	UTSW	11	109794154	nonsense	probably null
R2405:1700012B07Rik	UTSW	11	109794154	nonsense	probably null
R2410:1700012B07Rik	UTSW	11	109794154	nonsense	probably null
R2411:1700012B07Rik	UTSW	11	109794154	nonsense	probably null
R3707:1700012B07Rik	UTSW	11	109794154	nonsense	probably null
R3708:1700012B07Rik	UTSW	11	109794154	nonsense	probably null
R3732:1700012B07Rik	UTSW	11	109794154	nonsense	probably null
R3783:1700012B07Rik	UTSW	11	109794154	nonsense	probably null
R3784:1700012B07Rik	UTSW	11	109794154	nonsense	probably null
R3785:1700012B07Rik	UTSW	11	109794154	nonsense	probably null
R3805:1700012B07Rik	UTSW	11	109794154	nonsense	probably null
R3806:1700012B07Rik	UTSW	11	109794154	nonsense	probably null
R3922:1700012B07Rik	UTSW	11	109794154	nonsense	probably null
R3926:1700012B07Rik	UTSW	11	109794154	nonsense	probably null
R4085:1700012B07Rik	UTSW	11	109794154	nonsense	probably null
R4089:1700012B07Rik	UTSW	11	109794154	nonsense	probably null
R4110:1700012B07Rik	UTSW	11	109794154	nonsense	probably null
R4111:1700012B07Rik	UTSW	11	109794154	nonsense	probably null
R4112:1700012B07Rik	UTSW	11	109794154	nonsense	probably null
R4171:1700012B07Rik	UTSW	11	109794154	nonsense	probably null
R4506:1700012B07Rik	UTSW	11	109794261	missense	probably damaging	1.00
R4825:1700012B07Rik	UTSW	11	109791672	missense	probably benign	0.00
R5032:1700012B07Rik	UTSW	11	109794154	nonsense	probably null
R5033:1700012B07Rik	UTSW	11	109794154	nonsense	probably null
R5971:1700012B07Rik	UTSW	11	109794154	nonsense	probably null
R6078:1700012B07Rik	UTSW	11	109794154	nonsense	probably null
R6079:1700012B07Rik	UTSW	11	109794154	nonsense	probably null
R6138:1700012B07Rik	UTSW	11	109794154	nonsense	probably null
R6354:1700012B07Rik	UTSW	11	109794216	missense	probably benign	0.33
R8752:1700012B07Rik	UTSW	11	109813570	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- TTCCTCTGTAGATAATGAGTCCGG -3'
(R):5'- AGCTTGTCTAACGAAGCACCC -3'

Sequencing Primer
(F):5'- TCCGGAGAATAGATGCTTGCCAATC -3'
(R):5'- ACCCATGCAAACTGGTCCTTTG -3'

Posted On

2015-03-18