Incidental Mutation 'R3745:Psma3'
ID 271179
Institutional Source Beutler Lab
Gene Symbol Psma3
Ensembl Gene ENSMUSG00000060073
Gene Name proteasome (prosome, macropain) subunit, alpha type 3
Synonyms Lmpc8
MMRRC Submission 040731-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.927) question?
Stock # R3745 (G1)
Quality Score 225
Status Validated
Chromosome 12
Chromosomal Location 70974621-70996347 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 70978748 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 13 (S13P)
Ref Sequence ENSEMBL: ENSMUSP00000124082 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071704] [ENSMUST00000160027] [ENSMUST00000160864] [ENSMUST00000162626] [ENSMUST00000162851]
AlphaFold O70435
Predicted Effect probably benign
Transcript: ENSMUST00000071704
AA Change: S13P

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
Predicted Effect probably benign
Transcript: ENSMUST00000160027
AA Change: S13P

PolyPhen 2 Score 0.190 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000125548
Gene: ENSMUSG00000060073
AA Change: S13P

DomainStartEndE-ValueType
Proteasome_A_N 8 30 9.72e-9 SMART
Pfam:Proteasome 31 217 6.2e-53 PFAM
low complexity region 241 253 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160683
Predicted Effect probably benign
Transcript: ENSMUST00000160864
SMART Domains Protein: ENSMUSP00000124894
Gene: ENSMUSG00000060073

DomainStartEndE-ValueType
Pfam:Proteasome 1 142 1.7e-38 PFAM
low complexity region 166 178 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161041
Predicted Effect probably benign
Transcript: ENSMUST00000162626
AA Change: S13P

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
Predicted Effect possibly damaging
Transcript: ENSMUST00000162851
AA Change: S13P

PolyPhen 2 Score 0.856 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000124082
Gene: ENSMUSG00000060073
AA Change: S13P

DomainStartEndE-ValueType
Proteasome_A_N 8 30 9.72e-9 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163035
Meta Mutation Damage Score 0.8480 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 98% (44/45)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The proteasome is a multicatalytic proteinase complex with a highly ordered ring-shaped 20S core structure. The core structure is composed of 4 rings of 28 non-identical subunits; 2 rings are composed of 7 alpha subunits and 2 rings are composed of 7 beta subunits. Proteasomes are distributed throughout eukaryotic cells at a high concentration and cleave peptides in an ATP/ubiquitin-dependent process in a non-lysosomal pathway. An essential function of a modified proteasome, the immunoproteasome, is the processing of class I MHC peptides. This gene encodes a member of the peptidase T1A family, that is a 20S core alpha subunit. Two alternative transcripts encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012B07Rik G T 11: 109,794,154 C172* probably null Het
Acot9 G A X: 155,271,945 probably benign Het
Akap10 A G 11: 61,915,305 V199A probably benign Het
Aox4 C T 1: 58,245,870 H594Y probably damaging Het
Arhgap35 A T 7: 16,563,722 Y473N probably damaging Het
Aspn G A 13: 49,566,560 E351K probably damaging Het
Astn1 G T 1: 158,502,060 A162S probably damaging Het
Auts2 A G 5: 131,476,587 probably benign Het
Cog6 A T 3: 52,992,819 M507K probably benign Het
Crct1 C A 3: 93,014,707 probably benign Het
Cyp2d11 A C 15: 82,391,855 I175S probably benign Het
Dclk1 A G 3: 55,247,442 N98D possibly damaging Het
Erich5 T A 15: 34,470,732 C36S probably damaging Het
F5 A G 1: 164,186,779 I540V possibly damaging Het
Fam20a A T 11: 109,677,790 S303R probably benign Het
Fam214a T C 9: 75,009,862 V581A probably benign Het
Fat3 G A 9: 15,998,271 S2145F probably damaging Het
Gbp9 C A 5: 105,105,858 probably benign Het
Gm6408 G T 5: 146,484,436 V292F probably damaging Het
Kmt2a A G 9: 44,831,340 probably benign Het
Lrriq1 T C 10: 103,170,856 D1136G probably damaging Het
Macrod2 C A 2: 141,810,629 T204K probably damaging Het
Mlkl A G 8: 111,315,567 probably benign Het
Msantd1 T A 5: 34,923,467 V155E possibly damaging Het
Myo3b A G 2: 70,234,485 probably benign Het
Nbn T A 4: 15,976,163 C375S possibly damaging Het
Nell2 A C 15: 95,432,673 C231W probably damaging Het
Nipbl A G 15: 8,358,874 S421P probably benign Het
Npr3 A T 15: 11,905,491 V50E probably damaging Het
Olfr1425 A G 19: 12,074,380 L84P probably damaging Het
Pclo T C 5: 14,678,421 probably benign Het
Pkn3 A G 2: 30,090,341 K785R probably damaging Het
Ppef2 T A 5: 92,239,151 probably benign Het
Prdm10 T C 9: 31,340,407 I357T possibly damaging Het
Prrc2c G A 1: 162,698,185 T284I unknown Het
Ptch1 T G 13: 63,524,959 E944A probably benign Het
Rpl6l T C 10: 111,126,365 noncoding transcript Het
Tex11 A G X: 100,916,572 V522A probably benign Het
Thsd7b A G 1: 129,678,241 E573G probably benign Het
Tom1l1 A G 11: 90,657,741 S259P probably benign Het
Trpm8 A G 1: 88,348,327 E549G probably benign Het
Vmn1r66 C T 7: 10,274,321 A262T possibly damaging Het
Zc3h13 T A 14: 75,330,661 D1131E probably benign Het
Zfp445 A C 9: 122,854,726 D289E probably benign Het
Other mutations in Psma3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01898:Psma3 APN 12 70984674 missense probably benign 0.17
R0316:Psma3 UTSW 12 70983389 missense probably benign 0.01
R0669:Psma3 UTSW 12 70988495 splice site probably benign
R1933:Psma3 UTSW 12 70984694 missense probably benign 0.22
R2288:Psma3 UTSW 12 70994371 missense possibly damaging 0.70
R4479:Psma3 UTSW 12 70984781 unclassified probably benign
R5260:Psma3 UTSW 12 70984642 unclassified probably benign
R5384:Psma3 UTSW 12 70974765 missense probably damaging 1.00
R5457:Psma3 UTSW 12 70984565 missense probably benign
R5794:Psma3 UTSW 12 70990497 missense probably benign 0.00
R8348:Psma3 UTSW 12 70988476 missense probably damaging 1.00
R8448:Psma3 UTSW 12 70988476 missense probably damaging 1.00
R8814:Psma3 UTSW 12 70978806 missense probably benign 0.17
R9275:Psma3 UTSW 12 70994382 missense probably benign 0.04
R9278:Psma3 UTSW 12 70994382 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- AGCCCCACTCATTCTGGC -3'
(R):5'- TCAAGGTATGACACTTGTTTATGCT -3'

Sequencing Primer
(F):5'- TGTAAAGCACCCGTGAGTTC -3'
(R):5'- GGTATGACACTTGTTTATGCTAAAGC -3'
Posted On 2015-03-18