Incidental Mutation 'R3745:Aspn'
ID 271180
Institutional Source Beutler Lab
Gene Symbol Aspn
Ensembl Gene ENSMUSG00000021388
Gene Name asporin
Synonyms PLAP-1, SLRR1C, 4631401G09Rik
MMRRC Submission 040731-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R3745 (G1)
Quality Score 225
Status Validated
Chromosome 13
Chromosomal Location 49697919-49721041 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 49720036 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Lysine at position 351 (E351K)
Ref Sequence ENSEMBL: ENSMUSP00000136728 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021818] [ENSMUST00000021820] [ENSMUST00000177948]
AlphaFold Q99MQ4
Predicted Effect probably benign
Transcript: ENSMUST00000021818
SMART Domains Protein: ENSMUSP00000021818
Gene: ENSMUSG00000021391

DomainStartEndE-ValueType
coiled coil region 1 34 N/A INTRINSIC
Pfam:CENP-P 102 278 3.9e-89 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000021820
AA Change: E351K

PolyPhen 2 Score 0.959 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000021820
Gene: ENSMUSG00000021388
AA Change: E351K

DomainStartEndE-ValueType
low complexity region 36 47 N/A INTRINSIC
LRRNT 67 99 8.23e-6 SMART
LRR 98 117 3.36e2 SMART
LRR 118 141 2.49e-1 SMART
LRR 142 165 5.41e0 SMART
LRR 187 212 9.5e1 SMART
Blast:LRR 232 256 9e-6 BLAST
LRR 257 280 4.83e0 SMART
LRR 281 303 6.23e1 SMART
LRR 304 327 2.03e2 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000177948
AA Change: E351K

PolyPhen 2 Score 0.959 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000136728
Gene: ENSMUSG00000021388
AA Change: E351K

DomainStartEndE-ValueType
low complexity region 36 47 N/A INTRINSIC
LRRNT 67 99 8.23e-6 SMART
LRR 98 117 3.36e2 SMART
LRR 118 141 2.49e-1 SMART
LRR 142 165 5.41e0 SMART
LRR 187 212 9.5e1 SMART
Blast:LRR 232 256 9e-6 BLAST
LRR 257 280 4.83e0 SMART
LRR 281 303 6.23e1 SMART
LRR 304 327 2.03e2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221751
Meta Mutation Damage Score 0.1886 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 98% (44/45)
MGI Phenotype FUNCTION: This gene encodes a member of the small leucine-rich proteoglycan family. The encoded protein is an extracellular matrix protein that modulates the transforming growth factor-beta signaling pathway, regulating cartilage matrix gene expression and cartilage formation. The protein plays a role in the pathology of osteoarthritis. Alternative splicing results in multiple transcript variants.[provided by RefSeq, Feb 2010]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012B07Rik G T 11: 109,684,980 (GRCm39) C172* probably null Het
Acot9 G A X: 154,054,941 (GRCm39) probably benign Het
Akap10 A G 11: 61,806,131 (GRCm39) V199A probably benign Het
Aox4 C T 1: 58,285,029 (GRCm39) H594Y probably damaging Het
Arhgap35 A T 7: 16,297,647 (GRCm39) Y473N probably damaging Het
Astn1 G T 1: 158,329,630 (GRCm39) A162S probably damaging Het
Atosa T C 9: 74,917,144 (GRCm39) V581A probably benign Het
Auts2 A G 5: 131,505,425 (GRCm39) probably benign Het
Cog6 A T 3: 52,900,240 (GRCm39) M507K probably benign Het
Crct1 C A 3: 92,922,014 (GRCm39) probably benign Het
Cyp2d11 A C 15: 82,276,056 (GRCm39) I175S probably benign Het
Dclk1 A G 3: 55,154,863 (GRCm39) N98D possibly damaging Het
Erich5 T A 15: 34,470,878 (GRCm39) C36S probably damaging Het
F5 A G 1: 164,014,348 (GRCm39) I540V possibly damaging Het
Fam20a A T 11: 109,568,616 (GRCm39) S303R probably benign Het
Fat3 G A 9: 15,909,567 (GRCm39) S2145F probably damaging Het
Gbp9 C A 5: 105,253,724 (GRCm39) probably benign Het
Gm6408 G T 5: 146,421,246 (GRCm39) V292F probably damaging Het
Kmt2a A G 9: 44,742,637 (GRCm39) probably benign Het
Lrriq1 T C 10: 103,006,717 (GRCm39) D1136G probably damaging Het
Macrod2 C A 2: 141,652,549 (GRCm39) T204K probably damaging Het
Mlkl A G 8: 112,042,199 (GRCm39) probably benign Het
Msantd1 T A 5: 35,080,811 (GRCm39) V155E possibly damaging Het
Myo3b A G 2: 70,064,829 (GRCm39) probably benign Het
Nbn T A 4: 15,976,163 (GRCm39) C375S possibly damaging Het
Nell2 A C 15: 95,330,554 (GRCm39) C231W probably damaging Het
Nipbl A G 15: 8,388,358 (GRCm39) S421P probably benign Het
Npr3 A T 15: 11,905,577 (GRCm39) V50E probably damaging Het
Or4d10 A G 19: 12,051,744 (GRCm39) L84P probably damaging Het
Pclo T C 5: 14,728,435 (GRCm39) probably benign Het
Pkn3 A G 2: 29,980,353 (GRCm39) K785R probably damaging Het
Ppef2 T A 5: 92,387,010 (GRCm39) probably benign Het
Prdm10 T C 9: 31,251,703 (GRCm39) I357T possibly damaging Het
Prrc2c G A 1: 162,525,754 (GRCm39) T284I unknown Het
Psma3 T C 12: 71,025,522 (GRCm39) S13P possibly damaging Het
Ptch1 T G 13: 63,672,773 (GRCm39) E944A probably benign Het
Rpl6l T C 10: 110,962,226 (GRCm39) noncoding transcript Het
Tex11 A G X: 99,960,178 (GRCm39) V522A probably benign Het
Thsd7b A G 1: 129,605,978 (GRCm39) E573G probably benign Het
Tom1l1 A G 11: 90,548,567 (GRCm39) S259P probably benign Het
Trpm8 A G 1: 88,276,049 (GRCm39) E549G probably benign Het
Vmn1r66 C T 7: 10,008,248 (GRCm39) A262T possibly damaging Het
Zc3h13 T A 14: 75,568,101 (GRCm39) D1131E probably benign Het
Zfp445 A C 9: 122,683,791 (GRCm39) D289E probably benign Het
Other mutations in Aspn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00332:Aspn APN 13 49,719,968 (GRCm39) missense probably benign 0.06
IGL00796:Aspn APN 13 49,710,893 (GRCm39) missense probably damaging 0.98
IGL01088:Aspn APN 13 49,720,029 (GRCm39) missense probably benign 0.00
IGL02633:Aspn APN 13 49,705,363 (GRCm39) missense possibly damaging 0.93
IGL03180:Aspn APN 13 49,716,991 (GRCm39) missense probably damaging 1.00
PIT4544001:Aspn UTSW 13 49,707,458 (GRCm39) nonsense probably null
R0699:Aspn UTSW 13 49,705,258 (GRCm39) missense possibly damaging 0.63
R1445:Aspn UTSW 13 49,710,849 (GRCm39) missense possibly damaging 0.75
R1749:Aspn UTSW 13 49,705,261 (GRCm39) missense probably benign 0.01
R2907:Aspn UTSW 13 49,705,374 (GRCm39) missense probably damaging 1.00
R3744:Aspn UTSW 13 49,720,036 (GRCm39) missense probably damaging 0.96
R4625:Aspn UTSW 13 49,710,901 (GRCm39) missense probably benign
R5061:Aspn UTSW 13 49,720,080 (GRCm39) missense probably damaging 0.99
R5712:Aspn UTSW 13 49,716,995 (GRCm39) missense probably damaging 1.00
R7079:Aspn UTSW 13 49,720,031 (GRCm39) missense probably damaging 1.00
R7210:Aspn UTSW 13 49,719,967 (GRCm39) missense probably benign 0.14
R7273:Aspn UTSW 13 49,712,352 (GRCm39) missense probably benign 0.00
R7768:Aspn UTSW 13 49,710,871 (GRCm39) missense probably damaging 1.00
R7988:Aspn UTSW 13 49,705,353 (GRCm39) missense possibly damaging 0.92
R9517:Aspn UTSW 13 49,705,275 (GRCm39) missense
R9686:Aspn UTSW 13 49,710,829 (GRCm39) missense probably damaging 1.00
R9743:Aspn UTSW 13 49,705,150 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GGCCCATGTTCCAGATAAAAC -3'
(R):5'- AGAATCATTCATGTGCAGAAGGAC -3'

Sequencing Primer
(F):5'- CACATTTCTTTTTATATTTACCGGGC -3'
(R):5'- TGAGCATCAATAATTAGGCAAAATTC -3'
Posted On 2015-03-18