Mutagenetix > Incidental Mutation

Incidental Mutation 'R3745:Nipbl'

271184

Institutional Source

Beutler Lab

Gene Symbol

Nipbl

Ensembl Gene

ENSMUSG00000022141

Gene Name

NIPBL cohesin loading factor

Synonyms

4921518A06Rik, 4933421G18Rik

MMRRC Submission

040731-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.962) question?

Stock #

R3745 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

8290617-8444463 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 8358874 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 421 (S421P)

Ref Sequence

ENSEMBL: ENSMUSP00000059385 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000052965]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000052965
AA Change: S421P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000059385
Gene: ENSMUSG00000022141
AA Change: S421P

Domain	Start	End	E-Value	Type
low complexity region	22	41	N/A	INTRINSIC
low complexity region	322	338	N/A	INTRINSIC
low complexity region	367	376	N/A	INTRINSIC
low complexity region	447	462	N/A	INTRINSIC
low complexity region	473	490	N/A	INTRINSIC
low complexity region	639	652	N/A	INTRINSIC
low complexity region	1020	1037	N/A	INTRINSIC
low complexity region	1081	1097	N/A	INTRINSIC
low complexity region	1102	1107	N/A	INTRINSIC
low complexity region	1114	1139	N/A	INTRINSIC
low complexity region	1165	1176	N/A	INTRINSIC
low complexity region	1389	1396	N/A	INTRINSIC
low complexity region	1577	1586	N/A	INTRINSIC
coiled coil region	1628	1656	N/A	INTRINSIC
Pfam:Cohesin_HEAT	1788	1829	1.1e-14	PFAM
Pfam:Nipped-B_C	2269	2450	2.8e-68	PFAM
low complexity region	2477	2501	N/A	INTRINSIC
low complexity region	2502	2512	N/A	INTRINSIC
low complexity region	2538	2550	N/A	INTRINSIC
low complexity region	2626	2632	N/A	INTRINSIC
low complexity region	2660	2684	N/A	INTRINSIC

Meta Mutation Damage Score

0.0585

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 94.8%

Validation Efficiency

98% (44/45)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the homolog of the Drosophila melanogaster Nipped-B gene product and fungal Scc2-type sister chromatid cohesion proteins. The Drosophila protein facilitates enhancer-promoter communication of remote enhancers and plays a role in developmental regulation. It is also homologous to a family of chromosomal adherins with broad roles in sister chromatid cohesion, chromosome condensation, and DNA repair. The human protein has a bipartite nuclear targeting sequence and a putative HEAT repeat. Condensins, cohesins and other complexes with chromosome-related functions also contain HEAT repeats. Mutations in this gene result in Cornelia de Lange syndrome, a disorder characterized by dysmorphic facial features, growth delay, limb reduction defects, and mental retardation. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Nullizygous mice are embryonic lethal. Heterozygous null mice are growth-retarded and show various skeletal anomalies. Heterozygotes for a gene-trap allele are small and show craniofacial, heart, eye, hearing and behavioral defects, delayed bone maturation, reduced body fat, and postnatal mortality. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 44 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700012B07Rik	G	T	11: 109,794,154 (GRCm38)	C172*	probably null	Het
Acot9	G	A	X: 155,271,945 (GRCm38)		probably benign	Het
Akap10	A	G	11: 61,915,305 (GRCm38)	V199A	probably benign	Het
Aox4	C	T	1: 58,245,870 (GRCm38)	H594Y	probably damaging	Het
Arhgap35	A	T	7: 16,563,722 (GRCm38)	Y473N	probably damaging	Het
Aspn	G	A	13: 49,566,560 (GRCm38)	E351K	probably damaging	Het
Astn1	G	T	1: 158,502,060 (GRCm38)	A162S	probably damaging	Het
Atosa	T	C	9: 75,009,862 (GRCm38)	V581A	probably benign	Het
Auts2	A	G	5: 131,476,587 (GRCm38)		probably benign	Het
Cog6	A	T	3: 52,992,819 (GRCm38)	M507K	probably benign	Het
Crct1	C	A	3: 93,014,707 (GRCm38)		probably benign	Het
Cyp2d11	A	C	15: 82,391,855 (GRCm38)	I175S	probably benign	Het
Dclk1	A	G	3: 55,247,442 (GRCm38)	N98D	possibly damaging	Het
Erich5	T	A	15: 34,470,732 (GRCm38)	C36S	probably damaging	Het
F5	A	G	1: 164,186,779 (GRCm38)	I540V	possibly damaging	Het
Fam20a	A	T	11: 109,677,790 (GRCm38)	S303R	probably benign	Het
Fat3	G	A	9: 15,998,271 (GRCm38)	S2145F	probably damaging	Het
Gbp9	C	A	5: 105,105,858 (GRCm38)		probably benign	Het
Gm6408	G	T	5: 146,484,436 (GRCm38)	V292F	probably damaging	Het
Kmt2a	A	G	9: 44,831,340 (GRCm38)		probably benign	Het
Lrriq1	T	C	10: 103,170,856 (GRCm38)	D1136G	probably damaging	Het
Macrod2	C	A	2: 141,810,629 (GRCm38)	T204K	probably damaging	Het
Mlkl	A	G	8: 111,315,567 (GRCm38)		probably benign	Het
Msantd1	T	A	5: 34,923,467 (GRCm38)	V155E	possibly damaging	Het
Myo3b	A	G	2: 70,234,485 (GRCm38)		probably benign	Het
Nbn	T	A	4: 15,976,163 (GRCm38)	C375S	possibly damaging	Het
Nell2	A	C	15: 95,432,673 (GRCm38)	C231W	probably damaging	Het
Npr3	A	T	15: 11,905,491 (GRCm38)	V50E	probably damaging	Het
Or4d10	A	G	19: 12,074,380 (GRCm38)	L84P	probably damaging	Het
Pclo	T	C	5: 14,678,421 (GRCm38)		probably benign	Het
Pkn3	A	G	2: 30,090,341 (GRCm38)	K785R	probably damaging	Het
Ppef2	T	A	5: 92,239,151 (GRCm38)		probably benign	Het
Prdm10	T	C	9: 31,340,407 (GRCm38)	I357T	possibly damaging	Het
Prrc2c	G	A	1: 162,698,185 (GRCm38)	T284I	unknown	Het
Psma3	T	C	12: 70,978,748 (GRCm38)	S13P	possibly damaging	Het
Ptch1	T	G	13: 63,524,959 (GRCm38)	E944A	probably benign	Het
Rpl6l	T	C	10: 111,126,365 (GRCm38)		noncoding transcript	Het
Tex11	A	G	X: 100,916,572 (GRCm38)	V522A	probably benign	Het
Thsd7b	A	G	1: 129,678,241 (GRCm38)	E573G	probably benign	Het
Tom1l1	A	G	11: 90,657,741 (GRCm38)	S259P	probably benign	Het
Trpm8	A	G	1: 88,348,327 (GRCm38)	E549G	probably benign	Het
Vmn1r66	C	T	7: 10,274,321 (GRCm38)	A262T	possibly damaging	Het
Zc3h13	T	A	14: 75,330,661 (GRCm38)	D1131E	probably benign	Het
Zfp445	A	C	9: 122,854,726 (GRCm38)	D289E	probably benign	Het

Other mutations in Nipbl

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00417:Nipbl	APN	15	8,366,673 (GRCm38)	missense	probably damaging	0.98
IGL00712:Nipbl	APN	15	8,369,474 (GRCm38)	missense	probably damaging	0.97
IGL00789:Nipbl	APN	15	8,296,869 (GRCm38)	missense	probably damaging	1.00
IGL01025:Nipbl	APN	15	8,350,455 (GRCm38)	missense	possibly damaging	0.46
IGL01087:Nipbl	APN	15	8,350,497 (GRCm38)	missense	possibly damaging	0.67
IGL01474:Nipbl	APN	15	8,311,209 (GRCm38)	missense	possibly damaging	0.63
IGL01537:Nipbl	APN	15	8,350,539 (GRCm38)	missense	probably benign
IGL01723:Nipbl	APN	15	8,335,071 (GRCm38)	missense	possibly damaging	0.71
IGL01749:Nipbl	APN	15	8,361,821 (GRCm38)	missense	probably benign	0.13
IGL02398:Nipbl	APN	15	8,327,090 (GRCm38)	missense	probably damaging	1.00
IGL02437:Nipbl	APN	15	8,359,074 (GRCm38)	missense	probably damaging	1.00
IGL02450:Nipbl	APN	15	8,343,574 (GRCm38)	missense	probably damaging	0.99
IGL02477:Nipbl	APN	15	8,323,647 (GRCm38)	splice site	probably null
IGL02547:Nipbl	APN	15	8,351,598 (GRCm38)	missense	probably benign
IGL02678:Nipbl	APN	15	8,351,110 (GRCm38)	missense	possibly damaging	0.92
IGL02679:Nipbl	APN	15	8,295,553 (GRCm38)	missense	probably benign	0.34
IGL03003:Nipbl	APN	15	8,350,314 (GRCm38)	missense	probably damaging	1.00
IGL03117:Nipbl	APN	15	8,332,452 (GRCm38)	missense	probably damaging	1.00
IGL03162:Nipbl	APN	15	8,338,979 (GRCm38)	missense	probably benign	0.37
IGL03224:Nipbl	APN	15	8,293,085 (GRCm38)	missense	probably damaging	0.98
IGL03339:Nipbl	APN	15	8,350,876 (GRCm38)	missense	probably benign	0.12
R0346_Nipbl_297	UTSW	15	8,360,956 (GRCm38)	missense	probably damaging	0.99
R0347_Nipbl_476	UTSW	15	8,350,732 (GRCm38)	missense	probably benign
R3620_nipbl_616	UTSW	15	8,333,024 (GRCm38)	missense	probably damaging	0.99
R6388_Nipbl_651	UTSW	15	8,300,784 (GRCm38)	missense	probably damaging	0.99
R8441_Nipbl_224	UTSW	15	8,293,115 (GRCm38)	missense	probably benign	0.00
R0271:Nipbl	UTSW	15	8,361,737 (GRCm38)	missense	possibly damaging	0.76
R0346:Nipbl	UTSW	15	8,360,956 (GRCm38)	missense	probably damaging	0.99
R0347:Nipbl	UTSW	15	8,350,732 (GRCm38)	missense	probably benign
R0422:Nipbl	UTSW	15	8,351,628 (GRCm38)	missense	probably benign
R0486:Nipbl	UTSW	15	8,338,870 (GRCm38)	splice site	probably benign
R0652:Nipbl	UTSW	15	8,303,480 (GRCm38)	missense	probably benign	0.23
R0667:Nipbl	UTSW	15	8,361,004 (GRCm38)	missense	possibly damaging	0.86
R0689:Nipbl	UTSW	15	8,293,078 (GRCm38)	splice site	probably null
R0726:Nipbl	UTSW	15	8,351,555 (GRCm38)	missense	probably benign
R0881:Nipbl	UTSW	15	8,307,612 (GRCm38)	missense	probably damaging	0.98
R0904:Nipbl	UTSW	15	8,361,718 (GRCm38)	missense	probably benign
R0969:Nipbl	UTSW	15	8,292,228 (GRCm38)	missense	probably damaging	1.00
R1401:Nipbl	UTSW	15	8,372,173 (GRCm38)	missense	probably damaging	0.97
R1479:Nipbl	UTSW	15	8,350,289 (GRCm38)	missense	probably benign	0.00
R1495:Nipbl	UTSW	15	8,351,280 (GRCm38)	missense	probably benign	0.00
R1609:Nipbl	UTSW	15	8,366,664 (GRCm38)	missense	probably damaging	1.00
R1679:Nipbl	UTSW	15	8,302,912 (GRCm38)	missense	probably benign	0.31
R1756:Nipbl	UTSW	15	8,338,551 (GRCm38)	missense	possibly damaging	0.91
R1778:Nipbl	UTSW	15	8,319,488 (GRCm38)	missense	probably damaging	1.00
R1835:Nipbl	UTSW	15	8,343,517 (GRCm38)	missense	possibly damaging	0.80
R1883:Nipbl	UTSW	15	8,327,132 (GRCm38)	missense	probably damaging	1.00
R1914:Nipbl	UTSW	15	8,343,630 (GRCm38)	missense	possibly damaging	0.93
R1915:Nipbl	UTSW	15	8,343,630 (GRCm38)	missense	possibly damaging	0.93
R2030:Nipbl	UTSW	15	8,350,287 (GRCm38)	missense	probably damaging	1.00
R2046:Nipbl	UTSW	15	8,324,467 (GRCm38)	missense	probably benign	0.08
R2076:Nipbl	UTSW	15	8,311,207 (GRCm38)	missense	probably benign	0.11
R2163:Nipbl	UTSW	15	8,336,919 (GRCm38)	missense	probably damaging	0.99
R2170:Nipbl	UTSW	15	8,293,218 (GRCm38)	missense	probably damaging	1.00
R2425:Nipbl	UTSW	15	8,351,482 (GRCm38)	missense	probably benign	0.06
R2475:Nipbl	UTSW	15	8,335,006 (GRCm38)	missense	probably benign	0.05
R2484:Nipbl	UTSW	15	8,323,698 (GRCm38)	missense	probably damaging	0.99
R2970:Nipbl	UTSW	15	8,311,239 (GRCm38)	missense	probably damaging	1.00
R3116:Nipbl	UTSW	15	8,343,592 (GRCm38)	missense	probably benign	0.00
R3620:Nipbl	UTSW	15	8,333,024 (GRCm38)	missense	probably damaging	0.99
R3725:Nipbl	UTSW	15	8,295,661 (GRCm38)	missense	probably damaging	0.97
R3902:Nipbl	UTSW	15	8,350,246 (GRCm38)	missense	possibly damaging	0.94
R3960:Nipbl	UTSW	15	8,350,534 (GRCm38)	missense	probably benign
R4164:Nipbl	UTSW	15	8,338,934 (GRCm38)	missense	probably benign	0.24
R4246:Nipbl	UTSW	15	8,332,432 (GRCm38)	missense	probably damaging	1.00
R4381:Nipbl	UTSW	15	8,359,206 (GRCm38)	missense	probably benign	0.00
R4394:Nipbl	UTSW	15	8,361,861 (GRCm38)	missense	probably benign	0.00
R4439:Nipbl	UTSW	15	8,338,724 (GRCm38)	missense	probably damaging	0.98
R4440:Nipbl	UTSW	15	8,366,658 (GRCm38)	missense	probably damaging	0.98
R4441:Nipbl	UTSW	15	8,366,658 (GRCm38)	missense	probably damaging	0.98
R4672:Nipbl	UTSW	15	8,302,984 (GRCm38)	missense	probably damaging	1.00
R4749:Nipbl	UTSW	15	8,365,829 (GRCm38)	missense	possibly damaging	0.95
R5300:Nipbl	UTSW	15	8,351,497 (GRCm38)	missense	probably benign
R5428:Nipbl	UTSW	15	8,330,296 (GRCm38)	missense	probably benign	0.00
R5641:Nipbl	UTSW	15	8,366,712 (GRCm38)	missense	possibly damaging	0.93
R5643:Nipbl	UTSW	15	8,358,907 (GRCm38)	missense	probably benign
R5644:Nipbl	UTSW	15	8,358,907 (GRCm38)	missense	probably benign
R5681:Nipbl	UTSW	15	8,301,382 (GRCm38)	missense	probably benign	0.22
R5741:Nipbl	UTSW	15	8,324,649 (GRCm38)	missense	possibly damaging	0.47
R5899:Nipbl	UTSW	15	8,334,844 (GRCm38)	splice site	probably null
R5970:Nipbl	UTSW	15	8,296,818 (GRCm38)	missense	probably benign	0.27
R6041:Nipbl	UTSW	15	8,324,264 (GRCm38)	missense	probably damaging	1.00
R6059:Nipbl	UTSW	15	8,295,568 (GRCm38)	missense	probably damaging	1.00
R6213:Nipbl	UTSW	15	8,334,906 (GRCm38)	missense	probably damaging	1.00
R6216:Nipbl	UTSW	15	8,318,383 (GRCm38)	missense	probably damaging	0.99
R6236:Nipbl	UTSW	15	8,324,580 (GRCm38)	missense	possibly damaging	0.88
R6267:Nipbl	UTSW	15	8,300,895 (GRCm38)	missense	possibly damaging	0.46
R6296:Nipbl	UTSW	15	8,300,895 (GRCm38)	missense	possibly damaging	0.46
R6388:Nipbl	UTSW	15	8,300,784 (GRCm38)	missense	probably damaging	0.99
R6427:Nipbl	UTSW	15	8,351,565 (GRCm38)	missense	probably benign
R6707:Nipbl	UTSW	15	8,324,559 (GRCm38)	missense	probably benign	0.01
R6731:Nipbl	UTSW	15	8,322,590 (GRCm38)	missense	probably damaging	1.00
R6921:Nipbl	UTSW	15	8,303,485 (GRCm38)	missense	probably benign	0.28
R7239:Nipbl	UTSW	15	8,292,135 (GRCm38)	critical splice donor site	probably null
R7346:Nipbl	UTSW	15	8,343,606 (GRCm38)	missense	possibly damaging	0.94
R7485:Nipbl	UTSW	15	8,330,295 (GRCm38)	missense	probably benign	0.01
R7486:Nipbl	UTSW	15	8,295,636 (GRCm38)	missense	probably benign	0.25
R7598:Nipbl	UTSW	15	8,343,493 (GRCm38)	missense	probably benign	0.24
R7609:Nipbl	UTSW	15	8,305,872 (GRCm38)	missense	probably benign	0.27
R7674:Nipbl	UTSW	15	8,293,101 (GRCm38)	missense	probably benign	0.15
R7706:Nipbl	UTSW	15	8,351,526 (GRCm38)	missense	probably benign	0.01
R7760:Nipbl	UTSW	15	8,358,702 (GRCm38)	missense	probably damaging	1.00
R7766:Nipbl	UTSW	15	8,296,849 (GRCm38)	missense	probably benign	0.45
R7825:Nipbl	UTSW	15	8,291,487 (GRCm38)	missense	probably damaging	1.00
R7862:Nipbl	UTSW	15	8,325,752 (GRCm38)	missense	probably benign	0.06
R7958:Nipbl	UTSW	15	8,311,258 (GRCm38)	missense	possibly damaging	0.91
R8077:Nipbl	UTSW	15	8,311,250 (GRCm38)	missense	possibly damaging	0.49
R8119:Nipbl	UTSW	15	8,359,212 (GRCm38)	missense	probably benign	0.22
R8355:Nipbl	UTSW	15	8,335,044 (GRCm38)	missense	probably damaging	0.98
R8441:Nipbl	UTSW	15	8,293,115 (GRCm38)	missense	probably benign	0.00
R8455:Nipbl	UTSW	15	8,335,044 (GRCm38)	missense	probably damaging	0.98
R8717:Nipbl	UTSW	15	8,338,741 (GRCm38)	missense	probably benign
R8739:Nipbl	UTSW	15	8,303,420 (GRCm38)	missense	probably benign	0.08
R8854:Nipbl	UTSW	15	8,300,726 (GRCm38)	missense	probably damaging	1.00
R8887:Nipbl	UTSW	15	8,361,787 (GRCm38)	missense	probably damaging	1.00
R8942:Nipbl	UTSW	15	8,351,620 (GRCm38)	missense	probably benign
R8991:Nipbl	UTSW	15	8,291,513 (GRCm38)	missense	probably damaging	1.00
R9008:Nipbl	UTSW	15	8,327,124 (GRCm38)	missense	probably damaging	1.00
R9070:Nipbl	UTSW	15	8,338,731 (GRCm38)	missense	possibly damaging	0.82
R9116:Nipbl	UTSW	15	8,350,856 (GRCm38)	missense	probably benign	0.00
R9622:Nipbl	UTSW	15	8,336,889 (GRCm38)	missense	probably benign	0.27
R9778:Nipbl	UTSW	15	8,291,548 (GRCm38)	missense	probably benign	0.10
RF020:Nipbl	UTSW	15	8,358,934 (GRCm38)	missense	probably damaging	0.98
X0022:Nipbl	UTSW	15	8,351,715 (GRCm38)	missense	probably benign	0.05
X0027:Nipbl	UTSW	15	8,323,537 (GRCm38)	missense	probably damaging	1.00
Z1088:Nipbl	UTSW	15	8,307,882 (GRCm38)	missense	probably damaging	1.00
Z1176:Nipbl	UTSW	15	8,338,699 (GRCm38)	missense	possibly damaging	0.88
Z1177:Nipbl	UTSW	15	8,338,680 (GRCm38)	critical splice donor site	probably null
Z1177:Nipbl	UTSW	15	8,336,952 (GRCm38)	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TCAATGGCTGATTCTCGCTC -3'
(R):5'- TTAGCTCTCCAACCAAGGACTC -3'

Sequencing Primer
(F):5'- AATGGCTGATTCTCGCTCTATCCG -3'
(R):5'- AAGACTTTCTCGTGTAAGATCTTCAG -3'

Posted On

2015-03-18