Incidental Mutation 'R3745:Erich5'
ID271186
Institutional Source Beutler Lab
Gene Symbol Erich5
Ensembl Gene ENSMUSG00000044726
Gene Nameglutamate rich 5
SynonymsBC030476
MMRRC Submission 040731-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.483) question?
Stock #R3745 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location34453305-34473892 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 34470732 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 36 (C36S)
Ref Sequence ENSEMBL: ENSMUSP00000058182 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060894]
Predicted Effect probably damaging
Transcript: ENSMUST00000060894
AA Change: C36S

PolyPhen 2 Score 0.959 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000058182
Gene: ENSMUSG00000044726
AA Change: C36S

DomainStartEndE-ValueType
Pfam:DUF4573 95 251 4.6e-60 PFAM
coiled coil region 318 349 N/A INTRINSIC
low complexity region 353 358 N/A INTRINSIC
Meta Mutation Damage Score 0.0903 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 98% (44/45)
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012B07Rik G T 11: 109,794,154 C172* probably null Het
Acot9 G A X: 155,271,945 probably benign Het
Akap10 A G 11: 61,915,305 V199A probably benign Het
Aox4 C T 1: 58,245,870 H594Y probably damaging Het
Arhgap35 A T 7: 16,563,722 Y473N probably damaging Het
Aspn G A 13: 49,566,560 E351K probably damaging Het
Astn1 G T 1: 158,502,060 A162S probably damaging Het
Auts2 A G 5: 131,476,587 probably benign Het
Cog6 A T 3: 52,992,819 M507K probably benign Het
Crct1 C A 3: 93,014,707 probably benign Het
Cyp2d11 A C 15: 82,391,855 I175S probably benign Het
Dclk1 A G 3: 55,247,442 N98D possibly damaging Het
F5 A G 1: 164,186,779 I540V possibly damaging Het
Fam20a A T 11: 109,677,790 S303R probably benign Het
Fam214a T C 9: 75,009,862 V581A probably benign Het
Fat3 G A 9: 15,998,271 S2145F probably damaging Het
Gbp9 C A 5: 105,105,858 probably benign Het
Gm6408 G T 5: 146,484,436 V292F probably damaging Het
Kmt2a A G 9: 44,831,340 probably benign Het
Lrriq1 T C 10: 103,170,856 D1136G probably damaging Het
Macrod2 C A 2: 141,810,629 T204K probably damaging Het
Mlkl A G 8: 111,315,567 probably benign Het
Msantd1 T A 5: 34,923,467 V155E possibly damaging Het
Myo3b A G 2: 70,234,485 probably benign Het
Nbn T A 4: 15,976,163 C375S possibly damaging Het
Nell2 A C 15: 95,432,673 C231W probably damaging Het
Nipbl A G 15: 8,358,874 S421P probably benign Het
Npr3 A T 15: 11,905,491 V50E probably damaging Het
Olfr1425 A G 19: 12,074,380 L84P probably damaging Het
Pclo T C 5: 14,678,421 probably benign Het
Pkn3 A G 2: 30,090,341 K785R probably damaging Het
Ppef2 T A 5: 92,239,151 probably benign Het
Prdm10 T C 9: 31,340,407 I357T possibly damaging Het
Prrc2c G A 1: 162,698,185 T284I unknown Het
Psma3 T C 12: 70,978,748 S13P possibly damaging Het
Ptch1 T G 13: 63,524,959 E944A probably benign Het
Rpl6l T C 10: 111,126,365 noncoding transcript Het
Tex11 A G X: 100,916,572 V522A probably benign Het
Thsd7b A G 1: 129,678,241 E573G probably benign Het
Tom1l1 A G 11: 90,657,741 S259P probably benign Het
Trpm8 A G 1: 88,348,327 E549G probably benign Het
Vmn1r66 C T 7: 10,274,321 A262T possibly damaging Het
Zc3h13 T A 14: 75,330,661 D1131E probably benign Het
Zfp445 A C 9: 122,854,726 D289E probably benign Het
Other mutations in Erich5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02137:Erich5 APN 15 34470754 missense probably damaging 0.98
IGL02237:Erich5 APN 15 34471336 missense probably benign 0.13
IGL02457:Erich5 APN 15 34470853 missense probably damaging 1.00
R0311:Erich5 UTSW 15 34472939 makesense probably null
R0625:Erich5 UTSW 15 34471369 missense probably damaging 1.00
R2857:Erich5 UTSW 15 34471414 missense probably damaging 1.00
R4214:Erich5 UTSW 15 34471411 missense possibly damaging 0.89
R4646:Erich5 UTSW 15 34470966 missense possibly damaging 0.47
R6309:Erich5 UTSW 15 34471456 missense probably benign
R7002:Erich5 UTSW 15 34471362 missense probably damaging 0.98
R7151:Erich5 UTSW 15 34470949 missense probably damaging 0.99
R8523:Erich5 UTSW 15 34471356 missense probably benign 0.37
X0024:Erich5 UTSW 15 34470837 missense probably benign 0.07
Predicted Primers PCR Primer
(F):5'- AGGGCTTCGATCTAAGTGAGG -3'
(R):5'- TGCACTAGAGGCTCAATCTTC -3'

Sequencing Primer
(F):5'- CTTCGATCTAAGTGAGGGTTGTG -3'
(R):5'- CACTAGAGGCTCAATCTTCTTTGTGG -3'
Posted On2015-03-18