Incidental Mutation 'R3745:Nell2'
ID271188
Institutional Source Beutler Lab
Gene Symbol Nell2
Ensembl Gene ENSMUSG00000022454
Gene NameNEL-like 2
SynonymsA330108N19Rik, mel91
MMRRC Submission 040731-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3745 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location95075230-95528559 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 95432673 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Tryptophan at position 231 (C231W)
Ref Sequence ENSEMBL: ENSMUSP00000155490 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075275] [ENSMUST00000166170] [ENSMUST00000229933] [ENSMUST00000229981]
Predicted Effect probably damaging
Transcript: ENSMUST00000075275
AA Change: C231W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000074751
Gene: ENSMUSG00000022454
AA Change: C231W

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
TSPN 32 217 9.94e-64 SMART
LamG 86 216 3.97e-8 SMART
coiled coil region 242 271 N/A INTRINSIC
VWC 277 333 6.18e-10 SMART
VWC 337 398 3.57e0 SMART
EGF 403 442 2.02e-1 SMART
EGF_CA 443 484 2.8e-9 SMART
EGF_CA 485 525 9.47e-7 SMART
EGF 527 556 1.28e-3 SMART
EGF_CA 558 604 2.13e-9 SMART
EGF_like 605 644 9.39e-4 SMART
VWC 643 695 8.88e-1 SMART
VWC 703 758 1.13e-17 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000166170
AA Change: C231W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000131665
Gene: ENSMUSG00000022454
AA Change: C231W

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
TSPN 32 217 9.94e-64 SMART
LamG 86 216 3.97e-8 SMART
coiled coil region 242 271 N/A INTRINSIC
VWC 277 333 6.18e-10 SMART
VWC 337 398 3.57e0 SMART
EGF 403 442 2.02e-1 SMART
EGF_CA 443 484 2.8e-9 SMART
EGF_CA 485 525 9.47e-7 SMART
EGF 527 556 1.28e-3 SMART
EGF_CA 558 604 2.13e-9 SMART
EGF_like 605 644 9.39e-4 SMART
VWC 643 695 8.88e-1 SMART
VWC 703 758 1.13e-17 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000229933
AA Change: C231W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000229981
AA Change: C231W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.6265 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 98% (44/45)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a glycoprotein containing several von Willebrand factor C domains and epidermal growth factor (EGF)-like domains. The encoded protein acts as a homotrimer and is found in the cytoplasm. Several variants encoding a few different isoforms exist, and at least one isoform appears to be a secreted protein. Studies in mouse suggest that this protein plays a role in neural cell growth and differentiation as well as in oncogenesis. [provided by RefSeq, Feb 2009]
PHENOTYPE: Homozygous null mice display enhanced long term potentiation in the dentate gyrus of the hippocampus. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012B07Rik G T 11: 109,794,154 C172* probably null Het
Acot9 G A X: 155,271,945 probably benign Het
Akap10 A G 11: 61,915,305 V199A probably benign Het
Aox4 C T 1: 58,245,870 H594Y probably damaging Het
Arhgap35 A T 7: 16,563,722 Y473N probably damaging Het
Aspn G A 13: 49,566,560 E351K probably damaging Het
Astn1 G T 1: 158,502,060 A162S probably damaging Het
Auts2 A G 5: 131,476,587 probably benign Het
Cog6 A T 3: 52,992,819 M507K probably benign Het
Crct1 C A 3: 93,014,707 probably benign Het
Cyp2d11 A C 15: 82,391,855 I175S probably benign Het
Dclk1 A G 3: 55,247,442 N98D possibly damaging Het
Erich5 T A 15: 34,470,732 C36S probably damaging Het
F5 A G 1: 164,186,779 I540V possibly damaging Het
Fam20a A T 11: 109,677,790 S303R probably benign Het
Fam214a T C 9: 75,009,862 V581A probably benign Het
Fat3 G A 9: 15,998,271 S2145F probably damaging Het
Gbp9 C A 5: 105,105,858 probably benign Het
Gm6408 G T 5: 146,484,436 V292F probably damaging Het
Kmt2a A G 9: 44,831,340 probably benign Het
Lrriq1 T C 10: 103,170,856 D1136G probably damaging Het
Macrod2 C A 2: 141,810,629 T204K probably damaging Het
Mlkl A G 8: 111,315,567 probably benign Het
Msantd1 T A 5: 34,923,467 V155E possibly damaging Het
Myo3b A G 2: 70,234,485 probably benign Het
Nbn T A 4: 15,976,163 C375S possibly damaging Het
Nipbl A G 15: 8,358,874 S421P probably benign Het
Npr3 A T 15: 11,905,491 V50E probably damaging Het
Olfr1425 A G 19: 12,074,380 L84P probably damaging Het
Pclo T C 5: 14,678,421 probably benign Het
Pkn3 A G 2: 30,090,341 K785R probably damaging Het
Ppef2 T A 5: 92,239,151 probably benign Het
Prdm10 T C 9: 31,340,407 I357T possibly damaging Het
Prrc2c G A 1: 162,698,185 T284I unknown Het
Psma3 T C 12: 70,978,748 S13P possibly damaging Het
Ptch1 T G 13: 63,524,959 E944A probably benign Het
Rpl6l T C 10: 111,126,365 noncoding transcript Het
Tex11 A G X: 100,916,572 V522A probably benign Het
Thsd7b A G 1: 129,678,241 E573G probably benign Het
Tom1l1 A G 11: 90,657,741 S259P probably benign Het
Trpm8 A G 1: 88,348,327 E549G probably benign Het
Vmn1r66 C T 7: 10,274,321 A262T possibly damaging Het
Zc3h13 T A 14: 75,330,661 D1131E probably benign Het
Zfp445 A C 9: 122,854,726 D289E probably benign Het
Other mutations in Nell2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00559:Nell2 APN 15 95527285 missense possibly damaging 0.94
IGL00919:Nell2 APN 15 95383727 missense possibly damaging 0.88
IGL01124:Nell2 APN 15 95296179 missense probably damaging 1.00
IGL01356:Nell2 APN 15 95229183 missense probably damaging 0.99
IGL01865:Nell2 APN 15 95385081 missense possibly damaging 0.74
IGL02324:Nell2 APN 15 95229101 missense probably damaging 0.99
IGL02505:Nell2 APN 15 95296263 splice site probably benign
PIT4495001:Nell2 UTSW 15 95383727 missense probably benign 0.33
R0112:Nell2 UTSW 15 95431681 splice site probably benign
R0139:Nell2 UTSW 15 95432901 missense probably benign 0.13
R0355:Nell2 UTSW 15 95432901 missense probably benign 0.13
R0481:Nell2 UTSW 15 95432682 splice site probably null
R0535:Nell2 UTSW 15 95431607 missense probably benign 0.10
R0607:Nell2 UTSW 15 95229214 missense probably benign 0.06
R1378:Nell2 UTSW 15 95232521 missense probably damaging 1.00
R1688:Nell2 UTSW 15 95431613 missense probably damaging 0.97
R2054:Nell2 UTSW 15 95435109 missense probably benign 0.00
R2163:Nell2 UTSW 15 95429978 missense probably damaging 1.00
R2176:Nell2 UTSW 15 95435157 missense probably damaging 0.97
R5055:Nell2 UTSW 15 95473579 missense probably benign 0.00
R5184:Nell2 UTSW 15 95527809 missense possibly damaging 0.78
R5382:Nell2 UTSW 15 95229210 missense probably damaging 1.00
R6145:Nell2 UTSW 15 95473561 missense probably damaging 1.00
R6264:Nell2 UTSW 15 95346825 missense probably damaging 0.99
R6337:Nell2 UTSW 15 95385144 missense probably damaging 1.00
R6423:Nell2 UTSW 15 95527282 missense probably damaging 1.00
R6438:Nell2 UTSW 15 95232498 missense probably damaging 1.00
R6579:Nell2 UTSW 15 95385076 missense possibly damaging 0.88
R6810:Nell2 UTSW 15 95241587 missense probably damaging 1.00
R6894:Nell2 UTSW 15 95346887 missense probably damaging 1.00
R7016:Nell2 UTSW 15 95229151 missense possibly damaging 0.87
R7266:Nell2 UTSW 15 95435393 missense possibly damaging 0.50
R7761:Nell2 UTSW 15 95432669 missense probably damaging 1.00
R7839:Nell2 UTSW 15 95298938 missense probably benign 0.01
R7965:Nell2 UTSW 15 95231335 missense probably damaging 0.99
R8000:Nell2 UTSW 15 95435274 missense probably damaging 1.00
R8856:Nell2 UTSW 15 95383671 missense probably damaging 1.00
R8880:Nell2 UTSW 15 95231448 missense probably damaging 1.00
X0038:Nell2 UTSW 15 95527812 missense probably benign
Z1088:Nell2 UTSW 15 95435097 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGATTCCAATCCAGTCCCAGG -3'
(R):5'- CGAAGTAAGTCTGTCTGTCCTGC -3'

Sequencing Primer
(F):5'- CGCAGATTGGCTACTTTAAGG -3'
(R):5'- CCTGCCCTGTATGCTGTGATG -3'
Posted On2015-03-18