Mutagenetix > Incidental Mutation

Incidental Mutation 'R3745:Nell2'

271188

Institutional Source

Beutler Lab

Gene Symbol

Nell2

Ensembl Gene

ENSMUSG00000022454

Gene Name

NEL-like 2

Synonyms

A330108N19Rik, mel91

MMRRC Submission

040731-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R3745 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

95075230-95528559 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to C at 95432673 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Cysteine to Tryptophan at position 231 (C231W)

Ref Sequence

ENSEMBL: ENSMUSP00000155490 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000075275] [ENSMUST00000166170] [ENSMUST00000229933] [ENSMUST00000229981]

AlphaFold

Q61220

Predicted Effect

probably damaging
Transcript: ENSMUST00000075275
AA Change: C231W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000074751
Gene: ENSMUSG00000022454
AA Change: C231W

Domain	Start	End	E-Value	Type
signal peptide	1	24	N/A	INTRINSIC
TSPN	32	217	9.94e-64	SMART
LamG	86	216	3.97e-8	SMART
coiled coil region	242	271	N/A	INTRINSIC
VWC	277	333	6.18e-10	SMART
VWC	337	398	3.57e0	SMART
EGF	403	442	2.02e-1	SMART
EGF_CA	443	484	2.8e-9	SMART
EGF_CA	485	525	9.47e-7	SMART
EGF	527	556	1.28e-3	SMART
EGF_CA	558	604	2.13e-9	SMART
EGF_like	605	644	9.39e-4	SMART
VWC	643	695	8.88e-1	SMART
VWC	703	758	1.13e-17	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000166170
AA Change: C231W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000131665
Gene: ENSMUSG00000022454
AA Change: C231W

Domain	Start	End	E-Value	Type
signal peptide	1	24	N/A	INTRINSIC
TSPN	32	217	9.94e-64	SMART
LamG	86	216	3.97e-8	SMART
coiled coil region	242	271	N/A	INTRINSIC
VWC	277	333	6.18e-10	SMART
VWC	337	398	3.57e0	SMART
EGF	403	442	2.02e-1	SMART
EGF_CA	443	484	2.8e-9	SMART
EGF_CA	485	525	9.47e-7	SMART
EGF	527	556	1.28e-3	SMART
EGF_CA	558	604	2.13e-9	SMART
EGF_like	605	644	9.39e-4	SMART
VWC	643	695	8.88e-1	SMART
VWC	703	758	1.13e-17	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000229933
AA Change: C231W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Predicted Effect

probably damaging
Transcript: ENSMUST00000229981
AA Change: C231W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Meta Mutation Damage Score

0.6265

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 94.8%

Validation Efficiency

98% (44/45)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a glycoprotein containing several von Willebrand factor C domains and epidermal growth factor (EGF)-like domains. The encoded protein acts as a homotrimer and is found in the cytoplasm. Several variants encoding a few different isoforms exist, and at least one isoform appears to be a secreted protein. Studies in mouse suggest that this protein plays a role in neural cell growth and differentiation as well as in oncogenesis. [provided by RefSeq, Feb 2009]
PHENOTYPE: Homozygous null mice display enhanced long term potentiation in the dentate gyrus of the hippocampus. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 44 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700012B07Rik	G	T	11: 109,794,154	C172*	probably null	Het
Acot9	G	A	X: 155,271,945		probably benign	Het
Akap10	A	G	11: 61,915,305	V199A	probably benign	Het
Aox4	C	T	1: 58,245,870	H594Y	probably damaging	Het
Arhgap35	A	T	7: 16,563,722	Y473N	probably damaging	Het
Aspn	G	A	13: 49,566,560	E351K	probably damaging	Het
Astn1	G	T	1: 158,502,060	A162S	probably damaging	Het
Auts2	A	G	5: 131,476,587		probably benign	Het
Cog6	A	T	3: 52,992,819	M507K	probably benign	Het
Crct1	C	A	3: 93,014,707		probably benign	Het
Cyp2d11	A	C	15: 82,391,855	I175S	probably benign	Het
Dclk1	A	G	3: 55,247,442	N98D	possibly damaging	Het
Erich5	T	A	15: 34,470,732	C36S	probably damaging	Het
F5	A	G	1: 164,186,779	I540V	possibly damaging	Het
Fam20a	A	T	11: 109,677,790	S303R	probably benign	Het
Fam214a	T	C	9: 75,009,862	V581A	probably benign	Het
Fat3	G	A	9: 15,998,271	S2145F	probably damaging	Het
Gbp9	C	A	5: 105,105,858		probably benign	Het
Gm6408	G	T	5: 146,484,436	V292F	probably damaging	Het
Kmt2a	A	G	9: 44,831,340		probably benign	Het
Lrriq1	T	C	10: 103,170,856	D1136G	probably damaging	Het
Macrod2	C	A	2: 141,810,629	T204K	probably damaging	Het
Mlkl	A	G	8: 111,315,567		probably benign	Het
Msantd1	T	A	5: 34,923,467	V155E	possibly damaging	Het
Myo3b	A	G	2: 70,234,485		probably benign	Het
Nbn	T	A	4: 15,976,163	C375S	possibly damaging	Het
Nipbl	A	G	15: 8,358,874	S421P	probably benign	Het
Npr3	A	T	15: 11,905,491	V50E	probably damaging	Het
Olfr1425	A	G	19: 12,074,380	L84P	probably damaging	Het
Pclo	T	C	5: 14,678,421		probably benign	Het
Pkn3	A	G	2: 30,090,341	K785R	probably damaging	Het
Ppef2	T	A	5: 92,239,151		probably benign	Het
Prdm10	T	C	9: 31,340,407	I357T	possibly damaging	Het
Prrc2c	G	A	1: 162,698,185	T284I	unknown	Het
Psma3	T	C	12: 70,978,748	S13P	possibly damaging	Het
Ptch1	T	G	13: 63,524,959	E944A	probably benign	Het
Rpl6l	T	C	10: 111,126,365		noncoding transcript	Het
Tex11	A	G	X: 100,916,572	V522A	probably benign	Het
Thsd7b	A	G	1: 129,678,241	E573G	probably benign	Het
Tom1l1	A	G	11: 90,657,741	S259P	probably benign	Het
Trpm8	A	G	1: 88,348,327	E549G	probably benign	Het
Vmn1r66	C	T	7: 10,274,321	A262T	possibly damaging	Het
Zc3h13	T	A	14: 75,330,661	D1131E	probably benign	Het
Zfp445	A	C	9: 122,854,726	D289E	probably benign	Het

Other mutations in Nell2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00559:Nell2	APN	15	95527285	missense	possibly damaging	0.94
IGL00919:Nell2	APN	15	95383727	missense	possibly damaging	0.88
IGL01124:Nell2	APN	15	95296179	missense	probably damaging	1.00
IGL01356:Nell2	APN	15	95229183	missense	probably damaging	0.99
IGL01865:Nell2	APN	15	95385081	missense	possibly damaging	0.74
IGL02324:Nell2	APN	15	95229101	missense	probably damaging	0.99
IGL02505:Nell2	APN	15	95296263	splice site	probably benign
PIT4495001:Nell2	UTSW	15	95383727	missense	probably benign	0.33
R0112:Nell2	UTSW	15	95431681	splice site	probably benign
R0139:Nell2	UTSW	15	95432901	missense	probably benign	0.13
R0355:Nell2	UTSW	15	95432901	missense	probably benign	0.13
R0481:Nell2	UTSW	15	95432682	splice site	probably null
R0535:Nell2	UTSW	15	95431607	missense	probably benign	0.10
R0607:Nell2	UTSW	15	95229214	missense	probably benign	0.06
R1378:Nell2	UTSW	15	95232521	missense	probably damaging	1.00
R1688:Nell2	UTSW	15	95431613	missense	probably damaging	0.97
R2054:Nell2	UTSW	15	95435109	missense	probably benign	0.00
R2163:Nell2	UTSW	15	95429978	missense	probably damaging	1.00
R2176:Nell2	UTSW	15	95435157	missense	probably damaging	0.97
R5055:Nell2	UTSW	15	95473579	missense	probably benign	0.00
R5184:Nell2	UTSW	15	95527809	missense	possibly damaging	0.78
R5382:Nell2	UTSW	15	95229210	missense	probably damaging	1.00
R6145:Nell2	UTSW	15	95473561	missense	probably damaging	1.00
R6264:Nell2	UTSW	15	95346825	missense	probably damaging	0.99
R6337:Nell2	UTSW	15	95385144	missense	probably damaging	1.00
R6423:Nell2	UTSW	15	95527282	missense	probably damaging	1.00
R6438:Nell2	UTSW	15	95232498	missense	probably damaging	1.00
R6579:Nell2	UTSW	15	95385076	missense	possibly damaging	0.88
R6810:Nell2	UTSW	15	95241587	missense	probably damaging	1.00
R6894:Nell2	UTSW	15	95346887	missense	probably damaging	1.00
R7016:Nell2	UTSW	15	95229151	missense	possibly damaging	0.87
R7266:Nell2	UTSW	15	95435393	missense	possibly damaging	0.50
R7761:Nell2	UTSW	15	95432669	missense	probably damaging	1.00
R7839:Nell2	UTSW	15	95298938	missense	probably benign	0.01
R7965:Nell2	UTSW	15	95231335	missense	probably damaging	0.99
R8000:Nell2	UTSW	15	95435274	missense	probably damaging	1.00
R8856:Nell2	UTSW	15	95383671	missense	probably damaging	1.00
R8880:Nell2	UTSW	15	95231448	missense	probably damaging	1.00
R8951:Nell2	UTSW	15	95241543	missense	probably damaging	1.00
R9036:Nell2	UTSW	15	95296236	missense	probably damaging	1.00
R9071:Nell2	UTSW	15	95346801	nonsense	probably null
R9383:Nell2	UTSW	15	95385076	missense	possibly damaging	0.88
R9496:Nell2	UTSW	15	95296216	missense	probably benign	0.10
X0038:Nell2	UTSW	15	95527812	missense	probably benign
Z1088:Nell2	UTSW	15	95435097	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGATTCCAATCCAGTCCCAGG -3'
(R):5'- CGAAGTAAGTCTGTCTGTCCTGC -3'

Sequencing Primer
(F):5'- CGCAGATTGGCTACTTTAAGG -3'
(R):5'- CCTGCCCTGTATGCTGTGATG -3'

Posted On

2015-03-18