Incidental Mutation 'R3745:Or4d10'
ID 271189
Institutional Source Beutler Lab
Gene Symbol Or4d10
Ensembl Gene ENSMUSG00000067526
Gene Name olfactory receptor family 4 subfamily D member 10
Synonyms MOR239-7, GA_x6K02T2RE5P-2433425-2432490, Olfr1425
MMRRC Submission 040731-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.076) question?
Stock # R3745 (G1)
Quality Score 225
Status Validated
Chromosome 19
Chromosomal Location 12051059-12051994 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 12051744 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 84 (L84P)
Ref Sequence ENSEMBL: ENSMUSP00000151154 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087828] [ENSMUST00000207681] [ENSMUST00000214918]
AlphaFold K7N659
Predicted Effect possibly damaging
Transcript: ENSMUST00000087828
AA Change: L85P

PolyPhen 2 Score 0.929 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000085130
Gene: ENSMUSG00000067526
AA Change: L85P

DomainStartEndE-ValueType
Pfam:7tm_4 30 303 9.3e-48 PFAM
Pfam:7tm_1 40 286 8.8e-22 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207681
AA Change: L84P
Predicted Effect probably damaging
Transcript: ENSMUST00000214918
AA Change: L84P

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 98% (44/45)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012B07Rik G T 11: 109,684,980 (GRCm39) C172* probably null Het
Acot9 G A X: 154,054,941 (GRCm39) probably benign Het
Akap10 A G 11: 61,806,131 (GRCm39) V199A probably benign Het
Aox4 C T 1: 58,285,029 (GRCm39) H594Y probably damaging Het
Arhgap35 A T 7: 16,297,647 (GRCm39) Y473N probably damaging Het
Aspn G A 13: 49,720,036 (GRCm39) E351K probably damaging Het
Astn1 G T 1: 158,329,630 (GRCm39) A162S probably damaging Het
Atosa T C 9: 74,917,144 (GRCm39) V581A probably benign Het
Auts2 A G 5: 131,505,425 (GRCm39) probably benign Het
Cog6 A T 3: 52,900,240 (GRCm39) M507K probably benign Het
Crct1 C A 3: 92,922,014 (GRCm39) probably benign Het
Cyp2d11 A C 15: 82,276,056 (GRCm39) I175S probably benign Het
Dclk1 A G 3: 55,154,863 (GRCm39) N98D possibly damaging Het
Erich5 T A 15: 34,470,878 (GRCm39) C36S probably damaging Het
F5 A G 1: 164,014,348 (GRCm39) I540V possibly damaging Het
Fam20a A T 11: 109,568,616 (GRCm39) S303R probably benign Het
Fat3 G A 9: 15,909,567 (GRCm39) S2145F probably damaging Het
Gbp9 C A 5: 105,253,724 (GRCm39) probably benign Het
Gm6408 G T 5: 146,421,246 (GRCm39) V292F probably damaging Het
Kmt2a A G 9: 44,742,637 (GRCm39) probably benign Het
Lrriq1 T C 10: 103,006,717 (GRCm39) D1136G probably damaging Het
Macrod2 C A 2: 141,652,549 (GRCm39) T204K probably damaging Het
Mlkl A G 8: 112,042,199 (GRCm39) probably benign Het
Msantd1 T A 5: 35,080,811 (GRCm39) V155E possibly damaging Het
Myo3b A G 2: 70,064,829 (GRCm39) probably benign Het
Nbn T A 4: 15,976,163 (GRCm39) C375S possibly damaging Het
Nell2 A C 15: 95,330,554 (GRCm39) C231W probably damaging Het
Nipbl A G 15: 8,388,358 (GRCm39) S421P probably benign Het
Npr3 A T 15: 11,905,577 (GRCm39) V50E probably damaging Het
Pclo T C 5: 14,728,435 (GRCm39) probably benign Het
Pkn3 A G 2: 29,980,353 (GRCm39) K785R probably damaging Het
Ppef2 T A 5: 92,387,010 (GRCm39) probably benign Het
Prdm10 T C 9: 31,251,703 (GRCm39) I357T possibly damaging Het
Prrc2c G A 1: 162,525,754 (GRCm39) T284I unknown Het
Psma3 T C 12: 71,025,522 (GRCm39) S13P possibly damaging Het
Ptch1 T G 13: 63,672,773 (GRCm39) E944A probably benign Het
Rpl6l T C 10: 110,962,226 (GRCm39) noncoding transcript Het
Tex11 A G X: 99,960,178 (GRCm39) V522A probably benign Het
Thsd7b A G 1: 129,605,978 (GRCm39) E573G probably benign Het
Tom1l1 A G 11: 90,548,567 (GRCm39) S259P probably benign Het
Trpm8 A G 1: 88,276,049 (GRCm39) E549G probably benign Het
Vmn1r66 C T 7: 10,008,248 (GRCm39) A262T possibly damaging Het
Zc3h13 T A 14: 75,568,101 (GRCm39) D1131E probably benign Het
Zfp445 A C 9: 122,683,791 (GRCm39) D289E probably benign Het
Other mutations in Or4d10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01936:Or4d10 APN 19 12,051,421 (GRCm39) missense probably benign 0.00
IGL02508:Or4d10 APN 19 12,051,251 (GRCm39) missense possibly damaging 0.90
IGL03183:Or4d10 APN 19 12,051,392 (GRCm39) missense probably damaging 0.98
R1164:Or4d10 UTSW 19 12,051,605 (GRCm39) nonsense probably null
R1866:Or4d10 UTSW 19 12,051,183 (GRCm39) missense probably benign 0.03
R4364:Or4d10 UTSW 19 12,051,861 (GRCm39) missense probably benign 0.13
R4888:Or4d10 UTSW 19 12,051,679 (GRCm39) missense probably damaging 1.00
R4962:Or4d10 UTSW 19 12,051,639 (GRCm39) missense probably damaging 1.00
R5954:Or4d10 UTSW 19 12,051,447 (GRCm39) missense possibly damaging 0.96
R6383:Or4d10 UTSW 19 12,051,727 (GRCm39) missense probably damaging 1.00
R6409:Or4d10 UTSW 19 12,052,111 (GRCm39) start gained probably benign
R6417:Or4d10 UTSW 19 12,051,324 (GRCm39) missense probably benign 0.18
R6420:Or4d10 UTSW 19 12,051,324 (GRCm39) missense probably benign 0.18
R7109:Or4d10 UTSW 19 12,051,576 (GRCm39) missense probably benign
R7446:Or4d10 UTSW 19 12,051,061 (GRCm39) makesense probably null
R7505:Or4d10 UTSW 19 12,051,969 (GRCm39) missense possibly damaging 0.88
R9689:Or4d10 UTSW 19 12,051,567 (GRCm39) missense possibly damaging 0.90
Z1176:Or4d10 UTSW 19 12,051,274 (GRCm39) missense probably damaging 1.00
Z1176:Or4d10 UTSW 19 12,051,204 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAGGCCACTATTAACCCAATGC -3'
(R):5'- ATTTTCCTTGGCCTGACCCAAAG -3'

Sequencing Primer
(F):5'- CAACGGCCTCTGCTCATGATG -3'
(R):5'- TCAAGAAGTGAGCATGGTGC -3'
Posted On 2015-03-18