Incidental Mutation 'R3745:Olfr1425'
ID271189
Institutional Source Beutler Lab
Gene Symbol Olfr1425
Ensembl Gene ENSMUSG00000067526
Gene Nameolfactory receptor 1425
SynonymsGA_x6K02T2RE5P-2433425-2432490, MOR239-7
MMRRC Submission 040731-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.066) question?
Stock #R3745 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location12073234-12077731 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 12074380 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 84 (L84P)
Ref Sequence ENSEMBL: ENSMUSP00000151154 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087828] [ENSMUST00000207681] [ENSMUST00000214918]
Predicted Effect possibly damaging
Transcript: ENSMUST00000087828
AA Change: L85P

PolyPhen 2 Score 0.929 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000085130
Gene: ENSMUSG00000067526
AA Change: L85P

DomainStartEndE-ValueType
Pfam:7tm_4 30 303 9.3e-48 PFAM
Pfam:7tm_1 40 286 8.8e-22 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207681
AA Change: L84P
Predicted Effect probably damaging
Transcript: ENSMUST00000214918
AA Change: L84P

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 98% (44/45)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012B07Rik G T 11: 109,794,154 C172* probably null Het
Acot9 G A X: 155,271,945 probably benign Het
Akap10 A G 11: 61,915,305 V199A probably benign Het
Aox4 C T 1: 58,245,870 H594Y probably damaging Het
Arhgap35 A T 7: 16,563,722 Y473N probably damaging Het
Aspn G A 13: 49,566,560 E351K probably damaging Het
Astn1 G T 1: 158,502,060 A162S probably damaging Het
Auts2 A G 5: 131,476,587 probably benign Het
Cog6 A T 3: 52,992,819 M507K probably benign Het
Crct1 C A 3: 93,014,707 probably benign Het
Cyp2d11 A C 15: 82,391,855 I175S probably benign Het
Dclk1 A G 3: 55,247,442 N98D possibly damaging Het
Erich5 T A 15: 34,470,732 C36S probably damaging Het
F5 A G 1: 164,186,779 I540V possibly damaging Het
Fam20a A T 11: 109,677,790 S303R probably benign Het
Fam214a T C 9: 75,009,862 V581A probably benign Het
Fat3 G A 9: 15,998,271 S2145F probably damaging Het
Gbp9 C A 5: 105,105,858 probably benign Het
Gm6408 G T 5: 146,484,436 V292F probably damaging Het
Kmt2a A G 9: 44,831,340 probably benign Het
Lrriq1 T C 10: 103,170,856 D1136G probably damaging Het
Macrod2 C A 2: 141,810,629 T204K probably damaging Het
Mlkl A G 8: 111,315,567 probably benign Het
Msantd1 T A 5: 34,923,467 V155E possibly damaging Het
Myo3b A G 2: 70,234,485 probably benign Het
Nbn T A 4: 15,976,163 C375S possibly damaging Het
Nell2 A C 15: 95,432,673 C231W probably damaging Het
Nipbl A G 15: 8,358,874 S421P probably benign Het
Npr3 A T 15: 11,905,491 V50E probably damaging Het
Pclo T C 5: 14,678,421 probably benign Het
Pkn3 A G 2: 30,090,341 K785R probably damaging Het
Ppef2 T A 5: 92,239,151 probably benign Het
Prdm10 T C 9: 31,340,407 I357T possibly damaging Het
Prrc2c G A 1: 162,698,185 T284I unknown Het
Psma3 T C 12: 70,978,748 S13P possibly damaging Het
Ptch1 T G 13: 63,524,959 E944A probably benign Het
Rpl6l T C 10: 111,126,365 noncoding transcript Het
Tex11 A G X: 100,916,572 V522A probably benign Het
Thsd7b A G 1: 129,678,241 E573G probably benign Het
Tom1l1 A G 11: 90,657,741 S259P probably benign Het
Trpm8 A G 1: 88,348,327 E549G probably benign Het
Vmn1r66 C T 7: 10,274,321 A262T possibly damaging Het
Zc3h13 T A 14: 75,330,661 D1131E probably benign Het
Zfp445 A C 9: 122,854,726 D289E probably benign Het
Other mutations in Olfr1425
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01936:Olfr1425 APN 19 12074057 missense probably benign 0.00
IGL02508:Olfr1425 APN 19 12073887 missense possibly damaging 0.90
IGL03183:Olfr1425 APN 19 12074028 missense probably damaging 0.98
R1164:Olfr1425 UTSW 19 12074241 nonsense probably null
R1866:Olfr1425 UTSW 19 12073819 missense probably benign 0.03
R4364:Olfr1425 UTSW 19 12074497 missense probably benign 0.13
R4888:Olfr1425 UTSW 19 12074315 missense probably damaging 1.00
R4962:Olfr1425 UTSW 19 12074275 missense probably damaging 1.00
R5954:Olfr1425 UTSW 19 12074083 missense possibly damaging 0.96
R6383:Olfr1425 UTSW 19 12074363 missense probably damaging 1.00
R6409:Olfr1425 UTSW 19 12074747 start gained probably benign
R6417:Olfr1425 UTSW 19 12073960 missense probably benign 0.18
R6420:Olfr1425 UTSW 19 12073960 missense probably benign 0.18
R7109:Olfr1425 UTSW 19 12074212 missense probably benign
R7446:Olfr1425 UTSW 19 12073697 makesense probably null
R7505:Olfr1425 UTSW 19 12074605 missense possibly damaging 0.88
Z1176:Olfr1425 UTSW 19 12073840 missense probably damaging 1.00
Z1176:Olfr1425 UTSW 19 12073910 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAGGCCACTATTAACCCAATGC -3'
(R):5'- ATTTTCCTTGGCCTGACCCAAAG -3'

Sequencing Primer
(F):5'- CAACGGCCTCTGCTCATGATG -3'
(R):5'- TCAAGAAGTGAGCATGGTGC -3'
Posted On2015-03-18