Incidental Mutation 'R3751:Erc1'
ID271206
Institutional Source Beutler Lab
Gene Symbol Erc1
Ensembl Gene ENSMUSG00000030172
Gene NameELKS/RAB6-interacting/CAST family member 1
SynonymsB430107L16Rik, Rab6ip2, 5033405M01Rik, RAB6IP2A, 9630025C19Rik, RAB6IP2B
MMRRC Submission 040736-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3751 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location119570796-119848167 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 119824960 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 32 (H32L)
Ref Sequence ENSEMBL: ENSMUSP00000138823 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032279] [ENSMUST00000079582] [ENSMUST00000183703] [ENSMUST00000183880] [ENSMUST00000183911] [ENSMUST00000184838] [ENSMUST00000184864] [ENSMUST00000185139] [ENSMUST00000185143]
Predicted Effect possibly damaging
Transcript: ENSMUST00000032279
AA Change: H32L

PolyPhen 2 Score 0.533 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000032279
Gene: ENSMUSG00000030172
AA Change: H32L

DomainStartEndE-ValueType
low complexity region 13 34 N/A INTRINSIC
low complexity region 35 51 N/A INTRINSIC
Pfam:Cast 154 466 1.8e-142 PFAM
Pfam:Cast 453 838 3.5e-163 PFAM
Pfam:Cast 833 986 8e-61 PFAM
Pfam:RBD-FIP 1072 1112 1.5e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000079582
SMART Domains Protein: ENSMUSP00000078534
Gene: ENSMUSG00000030172

DomainStartEndE-ValueType
Pfam:Cast 3 349 8.9e-149 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000183703
AA Change: H32L

PolyPhen 2 Score 0.533 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000139031
Gene: ENSMUSG00000030172
AA Change: H32L

DomainStartEndE-ValueType
low complexity region 13 34 N/A INTRINSIC
low complexity region 35 51 N/A INTRINSIC
Pfam:Cast 154 986 6.9e-291 PFAM
Pfam:RBD-FIP 1072 1112 1.5e-14 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183741
Predicted Effect probably damaging
Transcript: ENSMUST00000183880
AA Change: H32L

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000138823
Gene: ENSMUSG00000030172
AA Change: H32L

DomainStartEndE-ValueType
low complexity region 13 34 N/A INTRINSIC
low complexity region 35 51 N/A INTRINSIC
Pfam:Cast 154 914 4.3e-296 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000183911
AA Change: H32L

PolyPhen 2 Score 0.861 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000139118
Gene: ENSMUSG00000030172
AA Change: H32L

DomainStartEndE-ValueType
low complexity region 13 34 N/A INTRINSIC
low complexity region 35 51 N/A INTRINSIC
Pfam:Cast 154 954 4.2e-293 PFAM
Pfam:RBD-FIP 1040 1080 8.5e-14 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000184838
AA Change: H32L

PolyPhen 2 Score 0.533 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000139030
Gene: ENSMUSG00000030172
AA Change: H32L

DomainStartEndE-ValueType
low complexity region 13 34 N/A INTRINSIC
low complexity region 35 51 N/A INTRINSIC
Pfam:Cast 154 942 3.5e-291 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000184864
AA Change: H32L

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000139256
Gene: ENSMUSG00000030172
AA Change: H32L

DomainStartEndE-ValueType
low complexity region 13 34 N/A INTRINSIC
low complexity region 35 51 N/A INTRINSIC
Pfam:Cast 154 982 2e-288 PFAM
Pfam:RBD-FIP 1068 1108 8.7e-14 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000185139
AA Change: H32L

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000139152
Gene: ENSMUSG00000030172
AA Change: H32L

DomainStartEndE-ValueType
low complexity region 13 34 N/A INTRINSIC
low complexity region 35 51 N/A INTRINSIC
Pfam:Cast 154 958 3.6e-295 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000185143
AA Change: H32L
SMART Domains Protein: ENSMUSP00000138989
Gene: ENSMUSG00000030172
AA Change: H32L

DomainStartEndE-ValueType
low complexity region 13 34 N/A INTRINSIC
low complexity region 35 51 N/A INTRINSIC
Pfam:Cast 154 224 1.7e-28 PFAM
Pfam:Cast 222 686 8e-145 PFAM
Meta Mutation Damage Score 0.1002 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.7%
Validation Efficiency 93% (43/46)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of a family of RIM-binding proteins. RIMs are active zone proteins that regulate neurotransmitter release. This gene has been found fused to the receptor-type tyrosine kinase gene RET by gene rearrangement due to the translocation t(10;12)(q11;p13) in thyroid papillary carcinoma. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2014]
PHENOTYPE: Mice homozygous for null mutations in this gene display embryonic lethality. Mice heterozygous for a gene trap null allele exhibit increased sensitivity to ionizing radiation-induced lethality, with males being more affected than females. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900092C05Rik G T 7: 12,556,046 R183I probably benign Het
BC016579 A T 16: 45,632,998 probably null Het
BC051665 A T 13: 60,783,331 F258I probably damaging Het
Brd1 C T 15: 88,689,618 V1093I possibly damaging Het
C77080 A G 4: 129,224,322 probably benign Het
Ccdc125 A G 13: 100,677,951 D13G possibly damaging Het
Ceacam18 T A 7: 43,641,948 H271Q probably damaging Het
Cep104 A G 4: 153,981,756 Y137C probably damaging Het
Clca1 A G 3: 145,018,663 V212A probably benign Het
Clca2 A T 3: 145,071,455 M885K probably benign Het
Col6a4 G T 9: 106,072,114 T774N probably damaging Het
D430041D05Rik T C 2: 104,255,058 T1049A possibly damaging Het
Dlk1 A G 12: 109,460,313 I276V probably benign Het
E2f1 C G 2: 154,564,022 G144R probably damaging Het
Efcab9 T C 11: 32,527,420 H34R probably benign Het
Ezh2 T C 6: 47,556,064 I141M possibly damaging Het
Fbln1 T A 15: 85,227,078 C144* probably null Het
Iqsec3 C T 6: 121,376,255 A1135T probably benign Het
Irak4 T C 15: 94,561,595 I364T probably damaging Het
Itpr1 T A 6: 108,349,680 I121N probably damaging Het
Krtap17-1 A T 11: 99,993,655 C95* probably null Het
Lrrd1 T A 5: 3,850,282 S196T probably benign Het
Man2c1 A G 9: 57,140,774 Y748C probably damaging Het
Map4 A G 9: 110,038,674 probably benign Het
Mib2 A G 4: 155,655,284 F810S probably damaging Het
Mtmr9 A G 14: 63,543,548 L31P probably damaging Het
Myo5c A G 9: 75,276,002 Q886R probably damaging Het
Olfr123 T C 17: 37,796,232 S263P possibly damaging Het
Olfr768 T A 10: 129,093,306 I223F probably damaging Het
Olfr871 C T 9: 20,213,260 L304F probably damaging Het
Paqr8 A G 1: 20,935,632 T337A probably benign Het
Pdgfd A T 9: 6,337,447 probably benign Het
Ppm1k T G 6: 57,524,860 E106A probably benign Het
Rbp3 A T 14: 33,956,012 E639V probably damaging Het
Rnf214 A C 9: 45,867,603 I581S probably damaging Het
Scaf11 A G 15: 96,418,536 V1049A probably damaging Het
Slc51a A G 16: 32,476,474 L262P probably benign Het
Slc6a21 G A 7: 45,280,504 V139I probably benign Het
Slc8a3 G T 12: 81,204,138 L684M probably damaging Het
Spg7 G C 8: 123,087,373 R457P probably damaging Het
Tnks1bp1 C T 2: 85,058,722 probably benign Het
Vmn1r189 T C 13: 22,102,212 T152A probably benign Het
Vmn2r-ps159 G T 4: 156,334,397 noncoding transcript Het
Zfp366 A G 13: 99,228,844 Y171C probably damaging Het
Other mutations in Erc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01302:Erc1 APN 6 119722303 missense probably damaging 0.96
IGL01345:Erc1 APN 6 119761263 nonsense probably null
IGL01370:Erc1 APN 6 119824465 missense probably damaging 1.00
IGL01443:Erc1 APN 6 119824471 missense probably damaging 1.00
IGL01550:Erc1 APN 6 119783394 missense probably damaging 0.96
IGL01798:Erc1 APN 6 119620337 missense possibly damaging 0.86
IGL02032:Erc1 APN 6 119630609 missense probably damaging 1.00
IGL02239:Erc1 APN 6 119773891 missense probably damaging 0.96
IGL02341:Erc1 APN 6 119594973 missense possibly damaging 0.92
couch UTSW 6 119743429 missense possibly damaging 0.81
divan UTSW 6 119753288 missense probably benign 0.27
PIT4498001:Erc1 UTSW 6 119779491 missense possibly damaging 0.92
R0149:Erc1 UTSW 6 119824830 missense probably damaging 1.00
R0277:Erc1 UTSW 6 119620328 missense probably damaging 1.00
R0323:Erc1 UTSW 6 119620328 missense probably damaging 1.00
R1053:Erc1 UTSW 6 119796926 missense probably damaging 1.00
R1252:Erc1 UTSW 6 119743392 missense possibly damaging 0.84
R1355:Erc1 UTSW 6 119743420 nonsense probably null
R1470:Erc1 UTSW 6 119694602 missense probably damaging 1.00
R1470:Erc1 UTSW 6 119694602 missense probably damaging 1.00
R1680:Erc1 UTSW 6 119575761 missense probably damaging 1.00
R1833:Erc1 UTSW 6 119743429 missense possibly damaging 0.81
R1954:Erc1 UTSW 6 119797305 missense probably damaging 1.00
R2037:Erc1 UTSW 6 119722255 missense possibly damaging 0.94
R2365:Erc1 UTSW 6 119575695 missense probably damaging 1.00
R4473:Erc1 UTSW 6 119848456 splice site probably null
R4778:Erc1 UTSW 6 119797337 splice site probably null
R4897:Erc1 UTSW 6 119777986 critical splice donor site probably null
R5260:Erc1 UTSW 6 119761159 missense probably damaging 1.00
R5382:Erc1 UTSW 6 119761272 missense probably benign 0.02
R5405:Erc1 UTSW 6 119824944 missense probably damaging 1.00
R5801:Erc1 UTSW 6 119773822 missense probably damaging 0.99
R6341:Erc1 UTSW 6 119777998 missense possibly damaging 0.94
R6588:Erc1 UTSW 6 119575726 missense possibly damaging 0.92
R7441:Erc1 UTSW 6 119824951 missense possibly damaging 0.86
R7486:Erc1 UTSW 6 119594946 nonsense probably null
R7532:Erc1 UTSW 6 119779631 missense probably benign 0.02
R7575:Erc1 UTSW 6 119824760 missense possibly damaging 0.93
R7576:Erc1 UTSW 6 119824760 missense possibly damaging 0.93
R7705:Erc1 UTSW 6 119824603 missense probably benign 0.33
R7740:Erc1 UTSW 6 119761188 missense probably benign 0.02
R7789:Erc1 UTSW 6 119773709 nonsense probably null
R7805:Erc1 UTSW 6 119713771 missense possibly damaging 0.85
R7833:Erc1 UTSW 6 119824486 nonsense probably null
R8039:Erc1 UTSW 6 119773665 nonsense probably null
R8229:Erc1 UTSW 6 119753288 missense probably benign 0.27
R8363:Erc1 UTSW 6 119753299 missense probably benign 0.00
R8794:Erc1 UTSW 6 119630655 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- AGAACGGCCAAGTGTCATG -3'
(R):5'- AAGATTGGACAGCTGCTGGC -3'

Sequencing Primer
(F):5'- CCAAGTGTCATGGTGCTTTTAG -3'
(R):5'- GCTGTAAGCTGACTTTATAGCCATAG -3'
Posted On2015-03-18