Incidental Mutation 'R3751:Krtap17-1'
ID271220
Institutional Source Beutler Lab
Gene Symbol Krtap17-1
Ensembl Gene ENSMUSG00000078252
Gene Namekeratin associated protein 17-1
Synonyms
MMRRC Submission 040736-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3751 (G1)
Quality Score94
Status Validated
Chromosome11
Chromosomal Location99993234-99993994 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 99993655 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Stop codon at position 95 (C95*)
Ref Sequence ENSEMBL: ENSMUSP00000100670 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000105049]
Predicted Effect probably null
Transcript: ENSMUST00000105049
AA Change: C95*
SMART Domains Protein: ENSMUSP00000100670
Gene: ENSMUSG00000078252
AA Change: C95*

DomainStartEndE-ValueType
low complexity region 18 96 N/A INTRINSIC
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.7%
Validation Efficiency 93% (43/46)
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900092C05Rik G T 7: 12,556,046 R183I probably benign Het
BC016579 A T 16: 45,632,998 probably null Het
BC051665 A T 13: 60,783,331 F258I probably damaging Het
Brd1 C T 15: 88,689,618 V1093I possibly damaging Het
C77080 A G 4: 129,224,322 probably benign Het
Ccdc125 A G 13: 100,677,951 D13G possibly damaging Het
Ceacam18 T A 7: 43,641,948 H271Q probably damaging Het
Cep104 A G 4: 153,981,756 Y137C probably damaging Het
Clca1 A G 3: 145,018,663 V212A probably benign Het
Clca2 A T 3: 145,071,455 M885K probably benign Het
Col6a4 G T 9: 106,072,114 T774N probably damaging Het
D430041D05Rik T C 2: 104,255,058 T1049A possibly damaging Het
Dlk1 A G 12: 109,460,313 I276V probably benign Het
E2f1 C G 2: 154,564,022 G144R probably damaging Het
Efcab9 T C 11: 32,527,420 H34R probably benign Het
Erc1 T A 6: 119,824,960 H32L probably damaging Het
Ezh2 T C 6: 47,556,064 I141M possibly damaging Het
Fbln1 T A 15: 85,227,078 C144* probably null Het
Iqsec3 C T 6: 121,376,255 A1135T probably benign Het
Irak4 T C 15: 94,561,595 I364T probably damaging Het
Itpr1 T A 6: 108,349,680 I121N probably damaging Het
Lrrd1 T A 5: 3,850,282 S196T probably benign Het
Man2c1 A G 9: 57,140,774 Y748C probably damaging Het
Map4 A G 9: 110,038,674 probably benign Het
Mib2 A G 4: 155,655,284 F810S probably damaging Het
Mtmr9 A G 14: 63,543,548 L31P probably damaging Het
Myo5c A G 9: 75,276,002 Q886R probably damaging Het
Olfr123 T C 17: 37,796,232 S263P possibly damaging Het
Olfr768 T A 10: 129,093,306 I223F probably damaging Het
Olfr871 C T 9: 20,213,260 L304F probably damaging Het
Paqr8 A G 1: 20,935,632 T337A probably benign Het
Pdgfd A T 9: 6,337,447 probably benign Het
Ppm1k T G 6: 57,524,860 E106A probably benign Het
Rbp3 A T 14: 33,956,012 E639V probably damaging Het
Rnf214 A C 9: 45,867,603 I581S probably damaging Het
Scaf11 A G 15: 96,418,536 V1049A probably damaging Het
Slc51a A G 16: 32,476,474 L262P probably benign Het
Slc6a21 G A 7: 45,280,504 V139I probably benign Het
Slc8a3 G T 12: 81,204,138 L684M probably damaging Het
Spg7 G C 8: 123,087,373 R457P probably damaging Het
Tnks1bp1 C T 2: 85,058,722 probably benign Het
Vmn1r189 T C 13: 22,102,212 T152A probably benign Het
Vmn2r-ps159 G T 4: 156,334,397 noncoding transcript Het
Zfp366 A G 13: 99,228,844 Y171C probably damaging Het
Other mutations in Krtap17-1
AlleleSourceChrCoordTypePredicted EffectPPH Score
ginny UTSW 11 99993655 nonsense probably null
R2321:Krtap17-1 UTSW 11 99993920 missense unknown
R4212:Krtap17-1 UTSW 11 99993914 missense unknown
R4213:Krtap17-1 UTSW 11 99993914 missense unknown
R5915:Krtap17-1 UTSW 11 99993618 missense unknown
Predicted Primers PCR Primer
(F):5'- TCTCCTATCAGAAATAACAGGAGAG -3'
(R):5'- GACTGCCTCAATTGCTGCTC -3'

Sequencing Primer
(F):5'- AGGAGAGGCATGTCGCTGTC -3'
(R):5'- TTGCTGCTCCCAGGAACAG -3'
Posted On2015-03-18