Mutagenetix > Incidental Mutation

Incidental Mutation 'R3751:Slc8a3'

271221

Institutional Source

Beutler Lab

Gene Symbol

Slc8a3

Ensembl Gene

ENSMUSG00000079055

Gene Name

solute carrier family 8 (sodium/calcium exchanger), member 3

Synonyms

Ncx3

MMRRC Submission

040736-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R3751 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

81197915-81333180 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 81204138 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Methionine at position 684 (L684M)

Ref Sequence

ENSEMBL: ENSMUSP00000138735 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000064594] [ENSMUST00000085238] [ENSMUST00000182208] [ENSMUST00000182366]

AlphaFold

S4R2P9

Predicted Effect

possibly damaging
Transcript: ENSMUST00000064594
AA Change: L683M

PolyPhen 2 Score 0.932 (Sensitivity: 0.80; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000063258
Gene: ENSMUSG00000079055
AA Change: L683M

Domain	Start	End	E-Value	Type
signal peptide	1	32	N/A	INTRINSIC
Pfam:Na_Ca_ex	79	250	1.3e-36	PFAM
Pfam:Na_Ca_ex_C	253	379	4.6e-57	PFAM
Calx_beta	385	485	3.25e-42	SMART
Calx_beta	519	619	1.04e-40	SMART
low complexity region	712	723	N/A	INTRINSIC
Pfam:Na_Ca_ex	754	919	2e-27	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000085238
AA Change: L677M

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000082334
Gene: ENSMUSG00000079055
AA Change: L677M

Domain	Start	End	E-Value	Type
signal peptide	1	32	N/A	INTRINSIC
Pfam:Na_Ca_ex	79	250	1.3e-36	PFAM
Pfam:Na_Ca_ex_C	253	379	4.6e-57	PFAM
Calx_beta	385	485	3.25e-42	SMART
Calx_beta	519	619	1.54e-43	SMART
low complexity region	705	716	N/A	INTRINSIC
Pfam:Na_Ca_ex	747	912	1.9e-27	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000182208
AA Change: L684M

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000138735
Gene: ENSMUSG00000079055
AA Change: L684M

Domain	Start	End	E-Value	Type
signal peptide	1	32	N/A	INTRINSIC
Pfam:Na_Ca_ex	89	248	8.1e-38	PFAM
Calx_beta	385	485	3.25e-42	SMART
Calx_beta	519	619	1.04e-40	SMART
low complexity region	712	723	N/A	INTRINSIC
Pfam:Na_Ca_ex	764	917	9.1e-27	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000182366
AA Change: L54M

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000138803
Gene: ENSMUSG00000079055
AA Change: L54M

Domain	Start	End	E-Value	Type
PDB:2LT9\|A	1	52	2e-28	PDB
low complexity region	82	93	N/A	INTRINSIC

Meta Mutation Damage Score

0.2075

Coding Region Coverage

1x: 99.1%
3x: 98.6%
10x: 97.2%
20x: 94.7%

Validation Efficiency

93% (43/46)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the sodium/calcium exchanger integral membrane protein family. Na+/Ca2+ exchange proteins are involved in maintaining Ca2+ homeostasis in a wide variety of cell types. The protein is regulated by intracellular calcium ions and is found in both the plasma membrane and intracellular organellar membranes, where exchange of Na+ for Ca2+ occurs in an electrogenic manner. Alternative splicing has been observed for this gene and multiple variants have been described. [provided by RefSeq, Aug 2013]
PHENOTYPE: Mice homozygous for disruptions in this gene display a normal phenotype. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 44 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2900092C05Rik	G	T	7: 12,556,046	R183I	probably benign	Het
BC016579	A	T	16: 45,632,998		probably null	Het
BC051665	A	T	13: 60,783,331	F258I	probably damaging	Het
Brd1	C	T	15: 88,689,618	V1093I	possibly damaging	Het
C77080	A	G	4: 129,224,322		probably benign	Het
Ccdc125	A	G	13: 100,677,951	D13G	possibly damaging	Het
Ceacam18	T	A	7: 43,641,948	H271Q	probably damaging	Het
Cep104	A	G	4: 153,981,756	Y137C	probably damaging	Het
Clca1	A	G	3: 145,018,663	V212A	probably benign	Het
Clca2	A	T	3: 145,071,455	M885K	probably benign	Het
Col6a4	G	T	9: 106,072,114	T774N	probably damaging	Het
D430041D05Rik	T	C	2: 104,255,058	T1049A	possibly damaging	Het
Dlk1	A	G	12: 109,460,313	I276V	probably benign	Het
E2f1	C	G	2: 154,564,022	G144R	probably damaging	Het
Efcab9	T	C	11: 32,527,420	H34R	probably benign	Het
Erc1	T	A	6: 119,824,960	H32L	probably damaging	Het
Ezh2	T	C	6: 47,556,064	I141M	possibly damaging	Het
Fbln1	T	A	15: 85,227,078	C144*	probably null	Het
Iqsec3	C	T	6: 121,376,255	A1135T	probably benign	Het
Irak4	T	C	15: 94,561,595	I364T	probably damaging	Het
Itpr1	T	A	6: 108,349,680	I121N	probably damaging	Het
Krtap17-1	A	T	11: 99,993,655	C95*	probably null	Het
Lrrd1	T	A	5: 3,850,282	S196T	probably benign	Het
Man2c1	A	G	9: 57,140,774	Y748C	probably damaging	Het
Map4	A	G	9: 110,038,674		probably benign	Het
Mib2	A	G	4: 155,655,284	F810S	probably damaging	Het
Mtmr9	A	G	14: 63,543,548	L31P	probably damaging	Het
Myo5c	A	G	9: 75,276,002	Q886R	probably damaging	Het
Olfr123	T	C	17: 37,796,232	S263P	possibly damaging	Het
Olfr768	T	A	10: 129,093,306	I223F	probably damaging	Het
Olfr871	C	T	9: 20,213,260	L304F	probably damaging	Het
Paqr8	A	G	1: 20,935,632	T337A	probably benign	Het
Pdgfd	A	T	9: 6,337,447		probably benign	Het
Ppm1k	T	G	6: 57,524,860	E106A	probably benign	Het
Rbp3	A	T	14: 33,956,012	E639V	probably damaging	Het
Rnf214	A	C	9: 45,867,603	I581S	probably damaging	Het
Scaf11	A	G	15: 96,418,536	V1049A	probably damaging	Het
Slc51a	A	G	16: 32,476,474	L262P	probably benign	Het
Slc6a21	G	A	7: 45,280,504	V139I	probably benign	Het
Spg7	G	C	8: 123,087,373	R457P	probably damaging	Het
Tnks1bp1	C	T	2: 85,058,722		probably benign	Het
Vmn1r189	T	C	13: 22,102,212	T152A	probably benign	Het
Vmn2r-ps159	G	T	4: 156,334,397		noncoding transcript	Het
Zfp366	A	G	13: 99,228,844	Y171C	probably damaging	Het

Other mutations in Slc8a3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00164:Slc8a3	APN	12	81314569	missense	probably benign
IGL01315:Slc8a3	APN	12	81314395	missense	probably damaging	0.97
IGL01365:Slc8a3	APN	12	81315376	missense	probably damaging	0.99
IGL01610:Slc8a3	APN	12	81315802	missense	probably damaging	1.00
IGL02227:Slc8a3	APN	12	81315683	missense	probably damaging	1.00
IGL02299:Slc8a3	APN	12	81315224	missense	probably damaging	0.98
IGL02548:Slc8a3	APN	12	81204156	splice site	probably benign
IGL02646:Slc8a3	APN	12	81315094	missense	probably damaging	1.00
IGL03135:Slc8a3	APN	12	81202249	missense	probably damaging	1.00
R0050:Slc8a3	UTSW	12	81315265	missense	probably damaging	1.00
R0627:Slc8a3	UTSW	12	81314842	missense	probably damaging	1.00
R0648:Slc8a3	UTSW	12	81314446	missense	probably damaging	1.00
R1342:Slc8a3	UTSW	12	81316016	missense	probably damaging	0.99
R1437:Slc8a3	UTSW	12	81315986	missense	probably damaging	0.99
R1470:Slc8a3	UTSW	12	81199710	missense	probably benign
R1470:Slc8a3	UTSW	12	81199710	missense	probably benign
R1557:Slc8a3	UTSW	12	81315557	missense	probably damaging	1.00
R1563:Slc8a3	UTSW	12	81205007	missense	possibly damaging	0.47
R1918:Slc8a3	UTSW	12	81314844	missense	probably damaging	0.99
R1930:Slc8a3	UTSW	12	81314446	missense	probably damaging	1.00
R1931:Slc8a3	UTSW	12	81314446	missense	probably damaging	1.00
R2232:Slc8a3	UTSW	12	81315220	missense	probably damaging	0.99
R2680:Slc8a3	UTSW	12	81202339	missense	probably damaging	0.99
R2941:Slc8a3	UTSW	12	81315179	missense	probably damaging	1.00
R3157:Slc8a3	UTSW	12	81314992	missense	probably damaging	1.00
R3159:Slc8a3	UTSW	12	81314992	missense	probably damaging	1.00
R3859:Slc8a3	UTSW	12	81314872	missense	probably damaging	0.99
R4240:Slc8a3	UTSW	12	81315176	missense	probably damaging	0.99
R4527:Slc8a3	UTSW	12	81315853	missense	probably damaging	1.00
R4547:Slc8a3	UTSW	12	81314851	missense	possibly damaging	0.76
R4951:Slc8a3	UTSW	12	81314699	missense	probably benign	0.31
R4951:Slc8a3	UTSW	12	81315986	missense	probably damaging	0.99
R5022:Slc8a3	UTSW	12	81199558	missense	probably damaging	0.96
R5049:Slc8a3	UTSW	12	81214132	missense	probably damaging	1.00
R5057:Slc8a3	UTSW	12	81199558	missense	probably damaging	0.96
R5104:Slc8a3	UTSW	12	81214134	missense	probably null	0.34
R5122:Slc8a3	UTSW	12	81314258	critical splice donor site	probably null
R5183:Slc8a3	UTSW	12	81314491	missense	possibly damaging	0.79
R5629:Slc8a3	UTSW	12	81199631	missense	probably damaging	1.00
R6062:Slc8a3	UTSW	12	81314350	missense	probably damaging	1.00
R6218:Slc8a3	UTSW	12	81199567	missense	probably benign
R6279:Slc8a3	UTSW	12	81314978	missense	probably damaging	0.99
R6300:Slc8a3	UTSW	12	81314978	missense	probably damaging	0.99
R6416:Slc8a3	UTSW	12	81315627	missense	probably damaging	1.00
R6790:Slc8a3	UTSW	12	81314432	missense	probably benign	0.00
R6999:Slc8a3	UTSW	12	81314755	missense	probably benign	0.06
R7195:Slc8a3	UTSW	12	81314273	missense	possibly damaging	0.95
R7268:Slc8a3	UTSW	12	81315053	missense	probably damaging	0.98
R7288:Slc8a3	UTSW	12	81216824	missense	possibly damaging	0.70
R7383:Slc8a3	UTSW	12	81315805	missense	probably damaging	1.00
R7392:Slc8a3	UTSW	12	81314803	missense	probably damaging	0.99
R7394:Slc8a3	UTSW	12	81214058	splice site	probably null
R7549:Slc8a3	UTSW	12	81314770	missense	probably benign	0.06
R7657:Slc8a3	UTSW	12	81314384	missense	probably damaging	1.00
R7699:Slc8a3	UTSW	12	81314473	missense	probably damaging	1.00
R7759:Slc8a3	UTSW	12	81314551	missense	probably benign
R7960:Slc8a3	UTSW	12	81216732	missense	probably benign	0.00
R7985:Slc8a3	UTSW	12	81314993	missense	probably damaging	1.00
R8059:Slc8a3	UTSW	12	81202258	missense	probably damaging	1.00
R8192:Slc8a3	UTSW	12	81199681	missense	probably damaging	1.00
R8397:Slc8a3	UTSW	12	81199768	missense	probably benign	0.45
R8413:Slc8a3	UTSW	12	81314678	missense	probably damaging	0.97
R8681:Slc8a3	UTSW	12	81315140	missense	probably benign
R9060:Slc8a3	UTSW	12	81214078	missense	probably benign	0.45
R9061:Slc8a3	UTSW	12	81216766	missense	probably damaging	0.99
R9267:Slc8a3	UTSW	12	81314434	missense	possibly damaging	0.77
R9416:Slc8a3	UTSW	12	81315064	missense	probably benign	0.06
R9519:Slc8a3	UTSW	12	81315552	missense	probably benign	0.30
R9531:Slc8a3	UTSW	12	81315223	missense	probably damaging	1.00
X0026:Slc8a3	UTSW	12	81315287	missense	probably benign	0.22
X0028:Slc8a3	UTSW	12	81314943	missense	probably damaging	1.00
Z1177:Slc8a3	UTSW	12	81314700	missense	possibly damaging	0.92
Z1177:Slc8a3	UTSW	12	81315876	missense	probably benign	0.13

Predicted Primers

PCR Primer
(F):5'- GGAAGATCCACTGTAGACTCTCC -3'
(R):5'- ACATTTCTCTGAGCACCTGC -3'

Sequencing Primer
(F):5'- GACTCTCCTTGGAAGTGATAAGCC -3'
(R):5'- GCACCTGCTGTCAGAATTCAC -3'

Posted On

2015-03-18