Incidental Mutation 'R3751:Vmn1r189'
ID271223
Institutional Source Beutler Lab
Gene Symbol Vmn1r189
Ensembl Gene ENSMUSG00000099611
Gene Namevomeronasal 1 receptor 189
SynonymsV1rh2
MMRRC Submission 040736-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.287) question?
Stock #R3751 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location22099762-22105824 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 22102212 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 152 (T152A)
Ref Sequence ENSEMBL: ENSMUSP00000154722 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000186062] [ENSMUST00000227357] [ENSMUST00000228428]
Predicted Effect probably benign
Transcript: ENSMUST00000075055
AA Change: T152A

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000074566
Gene: ENSMUSG00000061222
AA Change: T152A

DomainStartEndE-ValueType
Pfam:V1R 33 297 7.9e-35 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000186062
AA Change: T152A

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000140924
Gene: ENSMUSG00000099611
AA Change: T152A

DomainStartEndE-ValueType
Pfam:7tm_1 30 283 1e-7 PFAM
Pfam:V1R 33 297 7.9e-35 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000227357
AA Change: T152A

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
Predicted Effect probably benign
Transcript: ENSMUST00000228428
AA Change: T152A

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.7%
Validation Efficiency 93% (43/46)
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900092C05Rik G T 7: 12,556,046 R183I probably benign Het
BC016579 A T 16: 45,632,998 probably null Het
BC051665 A T 13: 60,783,331 F258I probably damaging Het
Brd1 C T 15: 88,689,618 V1093I possibly damaging Het
C77080 A G 4: 129,224,322 probably benign Het
Ccdc125 A G 13: 100,677,951 D13G possibly damaging Het
Ceacam18 T A 7: 43,641,948 H271Q probably damaging Het
Cep104 A G 4: 153,981,756 Y137C probably damaging Het
Clca1 A G 3: 145,018,663 V212A probably benign Het
Clca2 A T 3: 145,071,455 M885K probably benign Het
Col6a4 G T 9: 106,072,114 T774N probably damaging Het
D430041D05Rik T C 2: 104,255,058 T1049A possibly damaging Het
Dlk1 A G 12: 109,460,313 I276V probably benign Het
E2f1 C G 2: 154,564,022 G144R probably damaging Het
Efcab9 T C 11: 32,527,420 H34R probably benign Het
Erc1 T A 6: 119,824,960 H32L probably damaging Het
Ezh2 T C 6: 47,556,064 I141M possibly damaging Het
Fbln1 T A 15: 85,227,078 C144* probably null Het
Iqsec3 C T 6: 121,376,255 A1135T probably benign Het
Irak4 T C 15: 94,561,595 I364T probably damaging Het
Itpr1 T A 6: 108,349,680 I121N probably damaging Het
Krtap17-1 A T 11: 99,993,655 C95* probably null Het
Lrrd1 T A 5: 3,850,282 S196T probably benign Het
Man2c1 A G 9: 57,140,774 Y748C probably damaging Het
Map4 A G 9: 110,038,674 probably benign Het
Mib2 A G 4: 155,655,284 F810S probably damaging Het
Mtmr9 A G 14: 63,543,548 L31P probably damaging Het
Myo5c A G 9: 75,276,002 Q886R probably damaging Het
Olfr123 T C 17: 37,796,232 S263P possibly damaging Het
Olfr768 T A 10: 129,093,306 I223F probably damaging Het
Olfr871 C T 9: 20,213,260 L304F probably damaging Het
Paqr8 A G 1: 20,935,632 T337A probably benign Het
Pdgfd A T 9: 6,337,447 probably benign Het
Ppm1k T G 6: 57,524,860 E106A probably benign Het
Rbp3 A T 14: 33,956,012 E639V probably damaging Het
Rnf214 A C 9: 45,867,603 I581S probably damaging Het
Scaf11 A G 15: 96,418,536 V1049A probably damaging Het
Slc51a A G 16: 32,476,474 L262P probably benign Het
Slc6a21 G A 7: 45,280,504 V139I probably benign Het
Slc8a3 G T 12: 81,204,138 L684M probably damaging Het
Spg7 G C 8: 123,087,373 R457P probably damaging Het
Tnks1bp1 C T 2: 85,058,722 probably benign Het
Vmn2r-ps159 G T 4: 156,334,397 noncoding transcript Het
Zfp366 A G 13: 99,228,844 Y171C probably damaging Het
Other mutations in Vmn1r189
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03084:Vmn1r189 APN 13 22101838 nonsense probably null
R0437:Vmn1r189 UTSW 13 22102061 missense probably damaging 0.99
R1199:Vmn1r189 UTSW 13 22102658 missense probably damaging 0.99
R1795:Vmn1r189 UTSW 13 22102154 missense probably benign 0.03
R2251:Vmn1r189 UTSW 13 22102548 missense probably damaging 1.00
R3824:Vmn1r189 UTSW 13 22102212 missense probably benign 0.02
R3825:Vmn1r189 UTSW 13 22102212 missense probably benign 0.02
R3856:Vmn1r189 UTSW 13 22102269 missense possibly damaging 0.56
R4688:Vmn1r189 UTSW 13 22102119 missense probably damaging 0.99
R5665:Vmn1r189 UTSW 13 22102166 missense probably damaging 1.00
R5778:Vmn1r189 UTSW 13 22102382 missense probably damaging 0.99
R6149:Vmn1r189 UTSW 13 22101884 missense probably benign 0.33
R6431:Vmn1r189 UTSW 13 22102355 missense probably damaging 0.98
R6660:Vmn1r189 UTSW 13 22101896 missense possibly damaging 0.89
R6974:Vmn1r189 UTSW 13 22102458 missense probably damaging 1.00
R7051:Vmn1r189 UTSW 13 22102115 missense possibly damaging 0.58
R7269:Vmn1r189 UTSW 13 22102567 missense probably benign 0.00
R7330:Vmn1r189 UTSW 13 22102541 missense possibly damaging 0.95
R7611:Vmn1r189 UTSW 13 22102152 missense probably benign 0.02
R7894:Vmn1r189 UTSW 13 22101736 nonsense probably null
R8214:Vmn1r189 UTSW 13 22102131 missense probably benign 0.01
Z1177:Vmn1r189 UTSW 13 22101883 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TTCTGAAGGTAGAGGACATGC -3'
(R):5'- TTTACTTGACAAGGGTGGCC -3'

Sequencing Primer
(F):5'- AGAGGACATGCTGGTGGTGC -3'
(R):5'- GGGCCTCTCCATCTGCAC -3'
Posted On2015-03-18