Incidental Mutation 'R3752:Slc9a8'
ID271247
Institutional Source Beutler Lab
Gene Symbol Slc9a8
Ensembl Gene ENSMUSG00000039463
Gene Namesolute carrier family 9 (sodium/hydrogen exchanger), member 8
Synonyms1200006P13Rik, 6430709P13Rik, NHE8
MMRRC Submission 040737-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3752 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location167421712-167477000 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 167457352 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Asparagine at position 215 (H215N)
Ref Sequence ENSEMBL: ENSMUSP00000104841 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047815] [ENSMUST00000073873] [ENSMUST00000109218]
Predicted Effect probably benign
Transcript: ENSMUST00000047815
AA Change: H242N

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000044185
Gene: ENSMUSG00000039463
AA Change: H242N

DomainStartEndE-ValueType
low complexity region 44 51 N/A INTRINSIC
Pfam:Na_H_Exchanger 57 468 3.3e-69 PFAM
low complexity region 497 513 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000073873
AA Change: H215N

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000073536
Gene: ENSMUSG00000039463
AA Change: H215N

DomainStartEndE-ValueType
low complexity region 44 51 N/A INTRINSIC
Pfam:Na_H_Exchanger 54 441 3.5e-62 PFAM
low complexity region 470 486 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000109218
AA Change: H215N

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000104841
Gene: ENSMUSG00000039463
AA Change: H215N

DomainStartEndE-ValueType
low complexity region 44 51 N/A INTRINSIC
Pfam:Na_H_Exchanger 54 437 3.7e-61 PFAM
low complexity region 466 482 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125855
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131956
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139673
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141400
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148454
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149607
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155585
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 100% (49/49)
MGI Phenotype FUNCTION: This gene encodes a member of the Na+/H+ exchanger (NHE) family of integral membrane transporter proteins. The encoded protein is expressed on the apical membrane of the intestinal epithelial cells and plays an important role in mucosal protection. Loss of the encoded protein in mice results in a decrease in the number of goblet and mucin-positive cells, disorganization of the mucin layer, and a decrease in mucosal pH in the colon. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jan 2015]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit male infertility, impaired mucin synthesis and bicarbonate secretion in the colon, abnormal blood coagulation and increased length of the small intestine, cecum and ileum crypts. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A830018L16Rik T A 1: 11,518,680 I107N probably damaging Het
Adh1 G A 3: 138,288,794 V292I probably benign Het
Brd1 C T 15: 88,689,618 V1093I possibly damaging Het
Cep170 A G 1: 176,782,495 probably benign Het
Col4a4 G A 1: 82,480,494 P1120S probably damaging Het
Cramp1l A T 17: 24,971,558 N1067K probably damaging Het
Dhrs7c A G 11: 67,811,455 T90A probably damaging Het
E2f1 C G 2: 154,564,022 G144R probably damaging Het
Eml6 C A 11: 29,809,360 V798F probably benign Het
Ext1 A T 15: 53,075,910 V581E probably damaging Het
Fbf1 C T 11: 116,147,796 R833Q probably benign Het
Fbln1 T A 15: 85,227,078 C144* probably null Het
Gm10521 A G 1: 171,896,145 T8A unknown Het
Hapln4 A T 8: 70,086,965 L215F probably damaging Het
Hmgcr T C 13: 96,663,116 I157V probably damaging Het
Irak4 T C 15: 94,561,595 I364T probably damaging Het
Lama3 T A 18: 12,507,029 C1700S probably damaging Het
Lama5 C T 2: 180,187,222 C2042Y probably damaging Het
Lrrc9 T G 12: 72,460,806 Y360* probably null Het
Lrrd1 T A 5: 3,850,282 S196T probably benign Het
Mdc1 C T 17: 35,845,929 A76V probably damaging Het
Mei1 C T 15: 82,086,182 T428M probably damaging Het
Mib2 A G 4: 155,655,284 F810S probably damaging Het
Nobox T G 6: 43,307,233 K126N probably damaging Het
Ogn C T 13: 49,622,831 L249F probably benign Het
Olfr1129 A G 2: 87,575,713 I210V probably benign Het
Olfr2 A T 7: 107,001,475 Y128* probably null Het
Paqr8 A G 1: 20,935,632 T337A probably benign Het
Pcdhb15 T A 18: 37,473,757 V14E probably damaging Het
Perm1 A T 4: 156,217,946 I316L probably benign Het
Plxnb2 G A 15: 89,157,255 probably benign Het
Rab3il1 A T 19: 10,030,477 T227S probably benign Het
Rag2 A T 2: 101,630,776 Y477F probably damaging Het
Ralgapa2 A T 2: 146,421,631 V722E possibly damaging Het
Rbp3 A T 14: 33,956,012 E639V probably damaging Het
Sh2b1 A G 7: 126,468,787 V565A probably damaging Het
Skint6 T C 4: 112,842,899 probably benign Het
Slc47a1 C T 11: 61,344,381 R542Q possibly damaging Het
Slc6a5 T C 7: 49,936,314 probably null Het
Slit1 C T 19: 41,646,967 probably null Het
Snx1 A T 9: 66,105,651 probably null Het
Tbc1d30 T A 10: 121,272,168 N443I probably damaging Het
Tex15 T A 8: 33,571,415 M565K probably benign Het
Traf3ip1 T C 1: 91,500,917 probably benign Het
Traf3ip1 A G 1: 91,518,297 D384G probably damaging Het
Vldlr G A 19: 27,238,331 E243K probably damaging Het
Vps35 A G 8: 85,274,831 S453P probably benign Het
Zfp644 A G 5: 106,636,383 V766A probably benign Het
Other mutations in Slc9a8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01616:Slc9a8 APN 2 167424166 missense possibly damaging 0.46
IGL02626:Slc9a8 APN 2 167467677 splice site probably benign
costello UTSW 2 167451296 missense probably damaging 1.00
R0270:Slc9a8 UTSW 2 167451296 missense probably damaging 1.00
R0417:Slc9a8 UTSW 2 167457344 missense probably benign 0.00
R0504:Slc9a8 UTSW 2 167424205 missense probably benign
R0906:Slc9a8 UTSW 2 167434867 intron probably benign
R1216:Slc9a8 UTSW 2 167424121 missense probably benign 0.00
R1225:Slc9a8 UTSW 2 167471523 missense probably benign 0.20
R1604:Slc9a8 UTSW 2 167471432 missense probably benign 0.09
R1728:Slc9a8 UTSW 2 167424145 missense probably benign 0.00
R1729:Slc9a8 UTSW 2 167424145 missense probably benign 0.00
R1773:Slc9a8 UTSW 2 167471465 missense possibly damaging 0.57
R1775:Slc9a8 UTSW 2 167457358 missense probably benign 0.12
R1918:Slc9a8 UTSW 2 167424214 missense possibly damaging 0.95
R2312:Slc9a8 UTSW 2 167451276 missense probably benign 0.01
R3031:Slc9a8 UTSW 2 167451281 missense probably damaging 1.00
R3757:Slc9a8 UTSW 2 167424130 missense probably benign 0.01
R4499:Slc9a8 UTSW 2 167424193 missense probably benign 0.01
R4746:Slc9a8 UTSW 2 167441170 nonsense probably null
R4904:Slc9a8 UTSW 2 167471396 missense possibly damaging 0.51
R4969:Slc9a8 UTSW 2 167446529 missense probably benign 0.06
R5395:Slc9a8 UTSW 2 167467722 missense probably damaging 0.99
R5811:Slc9a8 UTSW 2 167471387 nonsense probably null
R5908:Slc9a8 UTSW 2 167451170 intron probably benign
R6311:Slc9a8 UTSW 2 167451220 missense probably damaging 1.00
R6443:Slc9a8 UTSW 2 167434821 missense probably benign 0.00
R6494:Slc9a8 UTSW 2 167424291 missense probably damaging 1.00
R7161:Slc9a8 UTSW 2 167465383 missense possibly damaging 0.90
R7322:Slc9a8 UTSW 2 167451302 missense probably damaging 1.00
R7354:Slc9a8 UTSW 2 167474131 missense possibly damaging 0.93
R7896:Slc9a8 UTSW 2 167465358 missense probably benign 0.07
R8095:Slc9a8 UTSW 2 167468971 missense probably damaging 0.99
R8725:Slc9a8 UTSW 2 167473534 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTTCCCTAGTTACCCAGGG -3'
(R):5'- CAAGAGTGATGCCATCAAGTG -3'

Sequencing Primer
(F):5'- TAGTTACCCAGGGCAGCCTTTG -3'
(R):5'- AGTGATGCCATCAAGTGTGATCCC -3'
Posted On2015-03-18