Incidental Mutation 'R3752:Plxnb2'
ID271277
Institutional Source Beutler Lab
Gene Symbol Plxnb2
Ensembl Gene ENSMUSG00000036606
Gene Nameplexin B2
SynonymsDebt, 1110007H23Rik
MMRRC Submission 040737-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.945) question?
Stock #R3752 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location89155549-89180788 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) G to A at 89157255 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000104955 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060808] [ENSMUST00000109331]
Predicted Effect probably benign
Transcript: ENSMUST00000060808
SMART Domains Protein: ENSMUSP00000051731
Gene: ENSMUSG00000036606

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Sema 34 452 8.87e-92 SMART
PSI 470 521 1.94e-10 SMART
PSI 616 669 4.09e-1 SMART
PSI 761 804 7.02e-8 SMART
IPT 805 896 8.14e-19 SMART
IPT 897 983 1.1e-15 SMART
IPT 985 1096 5.06e-6 SMART
Pfam:Plexin_cytopl 1275 1809 1.6e-225 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000109331
SMART Domains Protein: ENSMUSP00000104955
Gene: ENSMUSG00000036606

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Sema 34 452 8.87e-92 SMART
PSI 470 521 1.94e-10 SMART
PSI 616 669 4.09e-1 SMART
PSI 761 804 7.02e-8 SMART
IPT 805 896 8.14e-19 SMART
IPT 897 983 1.1e-15 SMART
IPT 985 1096 5.06e-6 SMART
Pfam:Plexin_cytopl 1274 1809 4.4e-251 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139372
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143014
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151418
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229966
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230393
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 100% (49/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Members of the B class of plexins, such as PLXNB2 are transmembrane receptors that participate in axon guidance and cell migration in response to semaphorins (Perrot et al. (2002) [PubMed 12183458]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Homozygotes for a targeted mutation of this gene die perinatally of exencephaly or survive and seem normal despite severe abnormalities in cerebellar layering and foliation; the external granule cell layer is disorganized due to continued proliferation and migration of differentiated granule cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A830018L16Rik T A 1: 11,518,680 I107N probably damaging Het
Adh1 G A 3: 138,288,794 V292I probably benign Het
Brd1 C T 15: 88,689,618 V1093I possibly damaging Het
Cep170 A G 1: 176,782,495 probably benign Het
Col4a4 G A 1: 82,480,494 P1120S probably damaging Het
Cramp1l A T 17: 24,971,558 N1067K probably damaging Het
Dhrs7c A G 11: 67,811,455 T90A probably damaging Het
E2f1 C G 2: 154,564,022 G144R probably damaging Het
Eml6 C A 11: 29,809,360 V798F probably benign Het
Ext1 A T 15: 53,075,910 V581E probably damaging Het
Fbf1 C T 11: 116,147,796 R833Q probably benign Het
Fbln1 T A 15: 85,227,078 C144* probably null Het
Gm10521 A G 1: 171,896,145 T8A unknown Het
Hapln4 A T 8: 70,086,965 L215F probably damaging Het
Hmgcr T C 13: 96,663,116 I157V probably damaging Het
Irak4 T C 15: 94,561,595 I364T probably damaging Het
Lama3 T A 18: 12,507,029 C1700S probably damaging Het
Lama5 C T 2: 180,187,222 C2042Y probably damaging Het
Lrrc9 T G 12: 72,460,806 Y360* probably null Het
Lrrd1 T A 5: 3,850,282 S196T probably benign Het
Mdc1 C T 17: 35,845,929 A76V probably damaging Het
Mei1 C T 15: 82,086,182 T428M probably damaging Het
Mib2 A G 4: 155,655,284 F810S probably damaging Het
Nobox T G 6: 43,307,233 K126N probably damaging Het
Ogn C T 13: 49,622,831 L249F probably benign Het
Olfr1129 A G 2: 87,575,713 I210V probably benign Het
Olfr2 A T 7: 107,001,475 Y128* probably null Het
Paqr8 A G 1: 20,935,632 T337A probably benign Het
Pcdhb15 T A 18: 37,473,757 V14E probably damaging Het
Perm1 A T 4: 156,217,946 I316L probably benign Het
Rab3il1 A T 19: 10,030,477 T227S probably benign Het
Rag2 A T 2: 101,630,776 Y477F probably damaging Het
Ralgapa2 A T 2: 146,421,631 V722E possibly damaging Het
Rbp3 A T 14: 33,956,012 E639V probably damaging Het
Sh2b1 A G 7: 126,468,787 V565A probably damaging Het
Skint6 T C 4: 112,842,899 probably benign Het
Slc47a1 C T 11: 61,344,381 R542Q possibly damaging Het
Slc6a5 T C 7: 49,936,314 probably null Het
Slc9a8 C A 2: 167,457,352 H215N probably benign Het
Slit1 C T 19: 41,646,967 probably null Het
Snx1 A T 9: 66,105,651 probably null Het
Tbc1d30 T A 10: 121,272,168 N443I probably damaging Het
Tex15 T A 8: 33,571,415 M565K probably benign Het
Traf3ip1 T C 1: 91,500,917 probably benign Het
Traf3ip1 A G 1: 91,518,297 D384G probably damaging Het
Vldlr G A 19: 27,238,331 E243K probably damaging Het
Vps35 A G 8: 85,274,831 S453P probably benign Het
Zfp644 A G 5: 106,636,383 V766A probably benign Het
Other mutations in Plxnb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00546:Plxnb2 APN 15 89162366 splice site probably benign
IGL01574:Plxnb2 APN 15 89162683 splice site probably null
IGL01695:Plxnb2 APN 15 89157214 missense possibly damaging 0.96
IGL01763:Plxnb2 APN 15 89161981 splice site probably null
IGL01921:Plxnb2 APN 15 89164271 missense possibly damaging 0.78
IGL02129:Plxnb2 APN 15 89160410 missense probably benign 0.04
IGL02153:Plxnb2 APN 15 89165813 nonsense probably null
IGL02637:Plxnb2 APN 15 89164057 missense possibly damaging 0.53
IGL02892:Plxnb2 APN 15 89161222 critical splice donor site probably null
IGL03108:Plxnb2 APN 15 89158031 missense probably benign 0.32
IGL03115:Plxnb2 APN 15 89162438 splice site probably benign
P0040:Plxnb2 UTSW 15 89162935 missense probably damaging 1.00
R0022:Plxnb2 UTSW 15 89163276 critical splice donor site probably null
R0095:Plxnb2 UTSW 15 89165331 missense probably benign
R0103:Plxnb2 UTSW 15 89161769 missense possibly damaging 0.85
R0544:Plxnb2 UTSW 15 89158613 splice site probably benign
R0671:Plxnb2 UTSW 15 89157981 missense probably benign 0.14
R1279:Plxnb2 UTSW 15 89162321 missense probably benign 0.02
R1530:Plxnb2 UTSW 15 89167192 missense probably benign
R1542:Plxnb2 UTSW 15 89165921 missense probably damaging 1.00
R1610:Plxnb2 UTSW 15 89158493 missense probably damaging 1.00
R1686:Plxnb2 UTSW 15 89162462 missense probably damaging 1.00
R1702:Plxnb2 UTSW 15 89161984 critical splice donor site probably null
R1996:Plxnb2 UTSW 15 89158768 missense probably benign 0.13
R1997:Plxnb2 UTSW 15 89158768 missense probably benign 0.13
R2031:Plxnb2 UTSW 15 89162810 nonsense probably null
R2049:Plxnb2 UTSW 15 89159002 missense probably damaging 1.00
R2072:Plxnb2 UTSW 15 89158451 missense probably damaging 1.00
R2076:Plxnb2 UTSW 15 89158026 missense probably damaging 1.00
R2140:Plxnb2 UTSW 15 89156562 missense probably benign 0.04
R2418:Plxnb2 UTSW 15 89161069 missense possibly damaging 0.72
R2419:Plxnb2 UTSW 15 89161069 missense possibly damaging 0.72
R3825:Plxnb2 UTSW 15 89166399 missense probably benign 0.05
R4154:Plxnb2 UTSW 15 89159642 missense probably damaging 0.98
R4197:Plxnb2 UTSW 15 89157018 missense probably damaging 1.00
R4385:Plxnb2 UTSW 15 89160623 missense probably damaging 0.96
R4434:Plxnb2 UTSW 15 89162803 missense probably damaging 1.00
R4678:Plxnb2 UTSW 15 89160928 missense probably benign 0.37
R4717:Plxnb2 UTSW 15 89157419 nonsense probably null
R4773:Plxnb2 UTSW 15 89166947 missense probably benign 0.06
R4905:Plxnb2 UTSW 15 89157411 missense probably damaging 1.00
R5368:Plxnb2 UTSW 15 89159593 missense possibly damaging 0.94
R5418:Plxnb2 UTSW 15 89166491 missense probably benign 0.00
R5484:Plxnb2 UTSW 15 89164209 splice site probably null
R5520:Plxnb2 UTSW 15 89167543 missense possibly damaging 0.65
R5566:Plxnb2 UTSW 15 89164020 missense probably benign 0.05
R5568:Plxnb2 UTSW 15 89157435 missense probably damaging 1.00
R5619:Plxnb2 UTSW 15 89162809 missense possibly damaging 0.92
R5685:Plxnb2 UTSW 15 89167032 missense probably damaging 1.00
R5688:Plxnb2 UTSW 15 89158696 missense probably damaging 1.00
R5809:Plxnb2 UTSW 15 89167571 missense possibly damaging 0.61
R5813:Plxnb2 UTSW 15 89160759 missense possibly damaging 0.81
R5866:Plxnb2 UTSW 15 89167572 missense probably damaging 1.00
R6016:Plxnb2 UTSW 15 89161022 missense possibly damaging 0.55
R6117:Plxnb2 UTSW 15 89158000 missense probably benign 0.04
R6187:Plxnb2 UTSW 15 89167258 missense probably damaging 1.00
R6260:Plxnb2 UTSW 15 89165291 missense probably benign 0.22
R6263:Plxnb2 UTSW 15 89161986 missense probably damaging 0.99
R6269:Plxnb2 UTSW 15 89160713 missense probably benign 0.18
R6351:Plxnb2 UTSW 15 89157770 missense possibly damaging 0.95
R6522:Plxnb2 UTSW 15 89164426 missense probably benign 0.18
R6856:Plxnb2 UTSW 15 89164320 missense probably benign 0.27
R6930:Plxnb2 UTSW 15 89160389 missense probably benign
R7354:Plxnb2 UTSW 15 89165725 missense possibly damaging 0.92
R7513:Plxnb2 UTSW 15 89158322 critical splice acceptor site probably null
R7522:Plxnb2 UTSW 15 89161774 missense probably benign 0.20
R7730:Plxnb2 UTSW 15 89162330 missense probably benign
R7766:Plxnb2 UTSW 15 89161271 missense probably benign 0.01
R7781:Plxnb2 UTSW 15 89157022 missense possibly damaging 0.89
X0027:Plxnb2 UTSW 15 89160713 missense probably benign 0.18
Z1177:Plxnb2 UTSW 15 89159096 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTCTGATGCCCTTGTAGTAGC -3'
(R):5'- AGTCATCGCACAGACCTTCATG -3'

Sequencing Primer
(F):5'- CCCTTGTAGTAGCTGCAGAG -3'
(R):5'- AGACCTTCATGGACGCCTGTAC -3'
Posted On2015-03-18