Incidental Mutation 'R3752:Irak4'
ID271279
Institutional Source Beutler Lab
Gene Symbol Irak4
Ensembl Gene ENSMUSG00000059883
Gene Nameinterleukin-1 receptor-associated kinase 4
SynonymsIRAK-4, 8430405M07Rik, NY-REN-64, 9330209D03Rik
MMRRC Submission 040737-MU
Accession Numbers

Ncbi RefSeq: NM_029926; VEGA: OTTMUST00000040437; MGI: 2182474

Is this an essential gene? Probably essential (E-score: 0.827) question?
Stock #R3752 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location94543643-94581815 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 94561595 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 364 (I364T)
Ref Sequence ENSEMBL: ENSMUSP00000104871 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074936] [ENSMUST00000109248]
Predicted Effect probably damaging
Transcript: ENSMUST00000074936
AA Change: I364T

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000074471
Gene: ENSMUSG00000059883
AA Change: I364T

DomainStartEndE-ValueType
PDB:1WH4|A 1 114 1e-78 PDB
Pfam:Pkinase_Tyr 187 454 3.3e-53 PFAM
Pfam:Pkinase 187 456 4.9e-53 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000109248
AA Change: I364T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000104871
Gene: ENSMUSG00000059883
AA Change: I364T

DomainStartEndE-ValueType
Pfam:Death 20 101 1.6e-6 PFAM
Pfam:Pkinase_Tyr 187 452 1.9e-51 PFAM
Pfam:Pkinase 188 452 1.3e-54 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138306
Meta Mutation Damage Score 0.6371 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 100% (49/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a kinase that activates NF-kappaB in both the Toll-like receptor (TLR) and T-cell receptor (TCR) signaling pathways. The protein is essential for most innate immune responses. Mutations in this gene result in IRAK4 deficiency and recurrent invasive pneumococcal disease. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2011]
PHENOTYPE: Homozygous mutant mice exhibit defects of the innate immune system and show increased susceptibility to bacterial infection. [provided by MGI curators]
Allele List at MGI

All alleles(6) : Targeted(5) Chemically induced(1)

Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A830018L16Rik T A 1: 11,518,680 I107N probably damaging Het
Adh1 G A 3: 138,288,794 V292I probably benign Het
Brd1 C T 15: 88,689,618 V1093I possibly damaging Het
Cep170 A G 1: 176,782,495 probably benign Het
Col4a4 G A 1: 82,480,494 P1120S probably damaging Het
Cramp1l A T 17: 24,971,558 N1067K probably damaging Het
Dhrs7c A G 11: 67,811,455 T90A probably damaging Het
E2f1 C G 2: 154,564,022 G144R probably damaging Het
Eml6 C A 11: 29,809,360 V798F probably benign Het
Ext1 A T 15: 53,075,910 V581E probably damaging Het
Fbf1 C T 11: 116,147,796 R833Q probably benign Het
Fbln1 T A 15: 85,227,078 C144* probably null Het
Gm10521 A G 1: 171,896,145 T8A unknown Het
Hapln4 A T 8: 70,086,965 L215F probably damaging Het
Hmgcr T C 13: 96,663,116 I157V probably damaging Het
Lama3 T A 18: 12,507,029 C1700S probably damaging Het
Lama5 C T 2: 180,187,222 C2042Y probably damaging Het
Lrrc9 T G 12: 72,460,806 Y360* probably null Het
Lrrd1 T A 5: 3,850,282 S196T probably benign Het
Mdc1 C T 17: 35,845,929 A76V probably damaging Het
Mei1 C T 15: 82,086,182 T428M probably damaging Het
Mib2 A G 4: 155,655,284 F810S probably damaging Het
Nobox T G 6: 43,307,233 K126N probably damaging Het
Ogn C T 13: 49,622,831 L249F probably benign Het
Olfr1129 A G 2: 87,575,713 I210V probably benign Het
Olfr2 A T 7: 107,001,475 Y128* probably null Het
Paqr8 A G 1: 20,935,632 T337A probably benign Het
Pcdhb15 T A 18: 37,473,757 V14E probably damaging Het
Perm1 A T 4: 156,217,946 I316L probably benign Het
Plxnb2 G A 15: 89,157,255 probably benign Het
Rab3il1 A T 19: 10,030,477 T227S probably benign Het
Rag2 A T 2: 101,630,776 Y477F probably damaging Het
Ralgapa2 A T 2: 146,421,631 V722E possibly damaging Het
Rbp3 A T 14: 33,956,012 E639V probably damaging Het
Sh2b1 A G 7: 126,468,787 V565A probably damaging Het
Skint6 T C 4: 112,842,899 probably benign Het
Slc47a1 C T 11: 61,344,381 R542Q possibly damaging Het
Slc6a5 T C 7: 49,936,314 probably null Het
Slc9a8 C A 2: 167,457,352 H215N probably benign Het
Slit1 C T 19: 41,646,967 probably null Het
Snx1 A T 9: 66,105,651 probably null Het
Tbc1d30 T A 10: 121,272,168 N443I probably damaging Het
Tex15 T A 8: 33,571,415 M565K probably benign Het
Traf3ip1 T C 1: 91,500,917 probably benign Het
Traf3ip1 A G 1: 91,518,297 D384G probably damaging Het
Vldlr G A 19: 27,238,331 E243K probably damaging Het
Vps35 A G 8: 85,274,831 S453P probably benign Het
Zfp644 A G 5: 106,636,383 V766A probably benign Het
Other mutations in Irak4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00679:Irak4 APN 15 94556628 missense probably benign 0.09
IGL00688:Irak4 APN 15 94566863 missense possibly damaging 0.68
IGL01870:Irak4 APN 15 94547870 missense probably benign 0.28
IGL02740:Irak4 APN 15 94567044 makesense probably null
IGL02897:Irak4 APN 15 94553991 missense probably benign 0.00
IGL03290:Irak4 APN 15 94551899 missense probably benign 0.01
otiose UTSW 15 94561484 missense probably damaging 1.00
R0057:Irak4 UTSW 15 94553872 missense probably benign 0.00
R2010:Irak4 UTSW 15 94551806 missense probably damaging 1.00
R3751:Irak4 UTSW 15 94561595 missense probably damaging 1.00
R3753:Irak4 UTSW 15 94561595 missense probably damaging 1.00
R3973:Irak4 UTSW 15 94554740 missense possibly damaging 0.73
R4687:Irak4 UTSW 15 94566823 missense probably damaging 1.00
R4704:Irak4 UTSW 15 94566900 splice site probably null
R5001:Irak4 UTSW 15 94558273 missense possibly damaging 0.91
R5392:Irak4 UTSW 15 94556684 missense probably benign
R5392:Irak4 UTSW 15 94556685 missense probably benign 0.39
R6280:Irak4 UTSW 15 94551810 nonsense probably null
R6390:Irak4 UTSW 15 94561486 missense probably damaging 1.00
R7643:Irak4 UTSW 15 94558828 missense probably benign 0.05
V8831:Irak4 UTSW 15 94561484 missense probably damaging 1.00
X0019:Irak4 UTSW 15 94554000 missense probably benign 0.00
X0027:Irak4 UTSW 15 94551930 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAAGCATGTTTTCCACCTTCAAATT -3'
(R):5'- AAAGACTCATGCACCAAAATATTCT -3'

Sequencing Primer
(F):5'- TGACTTTGGGCTTGCAC -3'
(R):5'- GCTTAGCAAAGTAAAGGCTCCTGC -3'
Posted On2015-03-18