Incidental Mutation 'R3753:Paqr8'
ID271288
Institutional Source Beutler Lab
Gene Symbol Paqr8
Ensembl Gene ENSMUSG00000025931
Gene Nameprogestin and adipoQ receptor family member VIII
Synonyms1700019B16Rik, 3110001D06Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3753 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location20890606-20939650 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 20935632 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 337 (T337A)
Ref Sequence ENSEMBL: ENSMUSP00000141054 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068880] [ENSMUST00000167119] [ENSMUST00000187651] [ENSMUST00000189400]
Predicted Effect probably benign
Transcript: ENSMUST00000068880
AA Change: T337A

PolyPhen 2 Score 0.228 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000069127
Gene: ENSMUSG00000025931
AA Change: T337A

DomainStartEndE-ValueType
Pfam:HlyIII 70 297 1.7e-47 PFAM
transmembrane domain 319 341 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000167119
AA Change: T337A

PolyPhen 2 Score 0.228 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000128781
Gene: ENSMUSG00000025931
AA Change: T337A

DomainStartEndE-ValueType
Pfam:HlyIII 70 297 1.2e-53 PFAM
transmembrane domain 319 341 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000187651
AA Change: T337A

PolyPhen 2 Score 0.228 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000140913
Gene: ENSMUSG00000025931
AA Change: T337A

DomainStartEndE-ValueType
Pfam:HlyIII 70 297 1.7e-47 PFAM
transmembrane domain 319 341 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000189400
AA Change: T337A

PolyPhen 2 Score 0.228 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000141054
Gene: ENSMUSG00000025931
AA Change: T337A

DomainStartEndE-ValueType
Pfam:HlyIII 70 297 1.7e-47 PFAM
transmembrane domain 319 341 N/A INTRINSIC
Meta Mutation Damage Score 0.1328 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency 98% (49/50)
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001J03Rik A T 5: 146,184,867 I74N probably damaging Het
Acp7 T A 7: 28,616,660 Y167F probably damaging Het
Acsl1 A T 8: 46,513,565 probably benign Het
Bcr T C 10: 75,135,940 V599A probably benign Het
Brd1 C T 15: 88,689,618 V1093I possibly damaging Het
Cep152 A G 2: 125,625,052 probably benign Het
Cstf2t T G 19: 31,083,295 L77R probably damaging Het
Drd3 C T 16: 43,817,103 R254W probably damaging Het
E2f1 C G 2: 154,564,022 G144R probably damaging Het
Fam103a1 C T 7: 81,767,647 R32C probably damaging Het
Fam187a C T 11: 102,885,849 P160S probably benign Het
Fam198a A T 9: 121,965,833 D351V probably damaging Het
Fat1 G A 8: 45,025,479 E2521K probably damaging Het
Fbln1 T A 15: 85,227,078 C144* probably null Het
Flii T C 11: 60,715,480 D1128G probably benign Het
Gata3 T A 2: 9,868,840 H281L probably benign Het
Gm20767 A T 13: 120,154,631 D2V possibly damaging Het
Iqsec3 C T 6: 121,376,255 A1135T probably benign Het
Irak4 T C 15: 94,561,595 I364T probably damaging Het
Mib2 A G 4: 155,655,284 F810S probably damaging Het
Nbn G A 4: 15,964,269 V115I probably damaging Het
Nfyc G T 4: 120,765,330 probably benign Het
Nup210 A T 6: 91,021,395 probably null Het
Olfr1057 C T 2: 86,374,915 V166I possibly damaging Het
Olfr123 T C 17: 37,796,232 S263P possibly damaging Het
Olfr330 C T 11: 58,529,690 A99T probably benign Het
Plce1 T C 19: 38,651,834 V508A probably benign Het
Prmt2 G T 10: 76,225,303 D116E probably benign Het
Prss51 T A 14: 64,096,175 probably benign Het
Prune2 T A 19: 17,125,454 V2659D probably benign Het
Ptpn3 C T 4: 57,270,144 R6H probably damaging Het
Rdh12 C T 12: 79,213,672 R181* probably null Het
Rsf1 T A 7: 97,662,152 D696E probably benign Het
Sh3rf2 C T 18: 42,111,308 R280C probably damaging Het
Slco6d1 T A 1: 98,499,777 I611K probably damaging Het
Snph G A 2: 151,593,454 P449L probably benign Het
Spg7 G C 8: 123,087,373 R457P probably damaging Het
Swap70 T A 7: 110,267,881 W297R probably damaging Het
Tcaf3 T A 6: 42,589,804 I784F probably damaging Het
Tox2 T A 2: 163,314,323 I138N probably damaging Het
Trim54 A C 5: 31,134,144 E203A probably damaging Het
Vmn2r19 A T 6: 123,315,589 T197S possibly damaging Het
Vmn2r28 T A 7: 5,488,027 H407L probably damaging Het
Wdr19 G A 5: 65,224,726 V430M probably damaging Het
Other mutations in Paqr8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01996:Paqr8 APN 1 20935404 missense probably damaging 1.00
IGL02720:Paqr8 APN 1 20935509 nonsense probably null
LCD18:Paqr8 UTSW 1 20914658 intron probably benign
R0190:Paqr8 UTSW 1 20935047 missense probably benign 0.00
R0566:Paqr8 UTSW 1 20935463 missense possibly damaging 0.63
R1491:Paqr8 UTSW 1 20934824 missense probably benign
R1885:Paqr8 UTSW 1 20935480 missense probably damaging 1.00
R3195:Paqr8 UTSW 1 20935033 missense probably damaging 1.00
R3751:Paqr8 UTSW 1 20935632 missense probably benign 0.23
R3752:Paqr8 UTSW 1 20935632 missense probably benign 0.23
R4748:Paqr8 UTSW 1 20935413 missense probably benign 0.06
R5207:Paqr8 UTSW 1 20935258 missense probably benign 0.00
R5264:Paqr8 UTSW 1 20935108 missense possibly damaging 0.93
R5267:Paqr8 UTSW 1 20934696 missense probably benign
R7389:Paqr8 UTSW 1 20935165 missense probably damaging 1.00
R7468:Paqr8 UTSW 1 20935218 missense probably damaging 1.00
Z1176:Paqr8 UTSW 1 20934798 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GGACATCAAATCTTCCACGC -3'
(R):5'- AATGGCCTGCATTTGAAATTCC -3'

Sequencing Primer
(F):5'- GACATCAAATCTTCCACGCCTTCC -3'
(R):5'- GGAAATCAAACCCTGGGCTTTCTG -3'
Posted On2015-03-18