Incidental Mutation 'R3753:Olfr1057'
ID271293
Institutional Source Beutler Lab
Gene Symbol Olfr1057
Ensembl Gene ENSMUSG00000075187
Gene Nameolfactory receptor 1057
SynonymsGA_x6K02T2Q125-47844843-47843896, MOR185-11
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.099) question?
Stock #R3753 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location86372561-86378393 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 86374915 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 166 (V166I)
Ref Sequence ENSEMBL: ENSMUSP00000150623 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099892] [ENSMUST00000217435]
Predicted Effect possibly damaging
Transcript: ENSMUST00000099892
AA Change: V166I

PolyPhen 2 Score 0.532 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000097477
Gene: ENSMUSG00000075187
AA Change: V166I

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 8.3e-47 PFAM
Pfam:7tm_1 41 290 1.4e-20 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000217435
AA Change: V166I

PolyPhen 2 Score 0.532 (Sensitivity: 0.88; Specificity: 0.90)
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency 98% (49/50)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001J03Rik A T 5: 146,184,867 I74N probably damaging Het
Acp7 T A 7: 28,616,660 Y167F probably damaging Het
Acsl1 A T 8: 46,513,565 probably benign Het
Bcr T C 10: 75,135,940 V599A probably benign Het
Brd1 C T 15: 88,689,618 V1093I possibly damaging Het
Cep152 A G 2: 125,625,052 probably benign Het
Cstf2t T G 19: 31,083,295 L77R probably damaging Het
Drd3 C T 16: 43,817,103 R254W probably damaging Het
E2f1 C G 2: 154,564,022 G144R probably damaging Het
Fam103a1 C T 7: 81,767,647 R32C probably damaging Het
Fam187a C T 11: 102,885,849 P160S probably benign Het
Fam198a A T 9: 121,965,833 D351V probably damaging Het
Fat1 G A 8: 45,025,479 E2521K probably damaging Het
Fbln1 T A 15: 85,227,078 C144* probably null Het
Flii T C 11: 60,715,480 D1128G probably benign Het
Gata3 T A 2: 9,868,840 H281L probably benign Het
Gm20767 A T 13: 120,154,631 D2V possibly damaging Het
Iqsec3 C T 6: 121,376,255 A1135T probably benign Het
Irak4 T C 15: 94,561,595 I364T probably damaging Het
Mib2 A G 4: 155,655,284 F810S probably damaging Het
Nbn G A 4: 15,964,269 V115I probably damaging Het
Nfyc G T 4: 120,765,330 probably benign Het
Nup210 A T 6: 91,021,395 probably null Het
Olfr123 T C 17: 37,796,232 S263P possibly damaging Het
Olfr330 C T 11: 58,529,690 A99T probably benign Het
Paqr8 A G 1: 20,935,632 T337A probably benign Het
Plce1 T C 19: 38,651,834 V508A probably benign Het
Prmt2 G T 10: 76,225,303 D116E probably benign Het
Prss51 T A 14: 64,096,175 probably benign Het
Prune2 T A 19: 17,125,454 V2659D probably benign Het
Ptpn3 C T 4: 57,270,144 R6H probably damaging Het
Rdh12 C T 12: 79,213,672 R181* probably null Het
Rsf1 T A 7: 97,662,152 D696E probably benign Het
Sh3rf2 C T 18: 42,111,308 R280C probably damaging Het
Slco6d1 T A 1: 98,499,777 I611K probably damaging Het
Snph G A 2: 151,593,454 P449L probably benign Het
Spg7 G C 8: 123,087,373 R457P probably damaging Het
Swap70 T A 7: 110,267,881 W297R probably damaging Het
Tcaf3 T A 6: 42,589,804 I784F probably damaging Het
Tox2 T A 2: 163,314,323 I138N probably damaging Het
Trim54 A C 5: 31,134,144 E203A probably damaging Het
Vmn2r19 A T 6: 123,315,589 T197S possibly damaging Het
Vmn2r28 T A 7: 5,488,027 H407L probably damaging Het
Wdr19 G A 5: 65,224,726 V430M probably damaging Het
Other mutations in Olfr1057
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02403:Olfr1057 APN 2 86374523 missense probably benign 0.05
IGL03267:Olfr1057 APN 2 86374634 nonsense probably null
R0133:Olfr1057 UTSW 2 86374815 missense possibly damaging 0.95
R0993:Olfr1057 UTSW 2 86374878 missense probably damaging 0.99
R1386:Olfr1057 UTSW 2 86374921 missense probably damaging 1.00
R1830:Olfr1057 UTSW 2 86375143 missense possibly damaging 0.95
R2398:Olfr1057 UTSW 2 86374839 missense probably damaging 0.98
R4394:Olfr1057 UTSW 2 86375179 missense possibly damaging 0.77
R4605:Olfr1057 UTSW 2 86374797 missense probably benign 0.01
R4835:Olfr1057 UTSW 2 86374509 missense possibly damaging 0.93
R5029:Olfr1057 UTSW 2 86374890 missense probably damaging 1.00
R5311:Olfr1057 UTSW 2 86374750 missense possibly damaging 0.91
R7487:Olfr1057 UTSW 2 86375131 missense probably damaging 1.00
R7667:Olfr1057 UTSW 2 86375181 missense probably damaging 0.99
R7770:Olfr1057 UTSW 2 86375260 missense possibly damaging 0.53
R7888:Olfr1057 UTSW 2 86374926 missense probably benign 0.02
R7971:Olfr1057 UTSW 2 86374926 missense probably benign 0.02
Z1176:Olfr1057 UTSW 2 86375115 missense possibly damaging 0.78
Predicted Primers PCR Primer
(F):5'- AGCACAAGTAGAGAAGGCTTTC -3'
(R):5'- AGCAGAGATCTTTATGCTGGCTG -3'

Sequencing Primer
(F):5'- GATGAACGGATCCTCAAAATTGC -3'
(R):5'- TGTGATGGCCTATGACCGC -3'
Posted On2015-03-18