Incidental Mutation 'R3753:Snph'
ID271295
Institutional Source Beutler Lab
Gene Symbol Snph
Ensembl Gene ENSMUSG00000027457
Gene Namesyntaphilin
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3753 (G1)
Quality Score174
Status Validated
Chromosome2
Chromosomal Location151590549-151632593 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 151593454 bp
ZygosityHeterozygous
Amino Acid Change Proline to Leucine at position 449 (P449L)
Ref Sequence ENSEMBL: ENSMUSP00000105503 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028950] [ENSMUST00000028951] [ENSMUST00000094456] [ENSMUST00000109875] [ENSMUST00000109877] [ENSMUST00000137936]
Predicted Effect probably benign
Transcript: ENSMUST00000028950
SMART Domains Protein: ENSMUSP00000028950
Gene: ENSMUSG00000027456

DomainStartEndE-ValueType
low complexity region 23 40 N/A INTRINSIC
PDZ 117 188 2.13e-9 SMART
PDZ 201 267 1.99e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000028951
AA Change: P518L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000028951
Gene: ENSMUSG00000027457
AA Change: P518L

DomainStartEndE-ValueType
low complexity region 4 27 N/A INTRINSIC
Pfam:Syntaphilin 50 367 9.3e-141 PFAM
low complexity region 436 449 N/A INTRINSIC
low complexity region 466 476 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000094456
AA Change: P485L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000092026
Gene: ENSMUSG00000027457
AA Change: P485L

DomainStartEndE-ValueType
Pfam:Syntaphilin 17 334 7.7e-141 PFAM
low complexity region 403 416 N/A INTRINSIC
low complexity region 433 443 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000109875
AA Change: P518L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000105501
Gene: ENSMUSG00000027457
AA Change: P518L

DomainStartEndE-ValueType
low complexity region 4 27 N/A INTRINSIC
Pfam:Syntaphilin 51 366 1.7e-145 PFAM
low complexity region 436 449 N/A INTRINSIC
low complexity region 466 476 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000109877
AA Change: P449L

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000105503
Gene: ENSMUSG00000027457
AA Change: P449L

DomainStartEndE-ValueType
Pfam:Syntaphilin 2 298 3.2e-125 PFAM
low complexity region 367 380 N/A INTRINSIC
low complexity region 397 407 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000137936
SMART Domains Protein: ENSMUSP00000123255
Gene: ENSMUSG00000027457

DomainStartEndE-ValueType
Pfam:Syntaphilin 17 87 4.6e-39 PFAM
Meta Mutation Damage Score 0.0759 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency 98% (49/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Syntaxin-1, synaptobrevin/VAMP, and SNAP25 interact to form the SNARE complex, which is required for synaptic vesicle docking and fusion. The protein encoded by this gene is membrane-associated and inhibits SNARE complex formation by binding free syntaxin-1. Expression of this gene appears to be brain-specific. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Dec 2015]
PHENOTYPE: Mice with disruptions in this gene are viable, fertile, and morphologically normal. However, they do display subtile deficiencies in coordination. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001J03Rik A T 5: 146,184,867 I74N probably damaging Het
Acp7 T A 7: 28,616,660 Y167F probably damaging Het
Acsl1 A T 8: 46,513,565 probably benign Het
Bcr T C 10: 75,135,940 V599A probably benign Het
Brd1 C T 15: 88,689,618 V1093I possibly damaging Het
Cep152 A G 2: 125,625,052 probably benign Het
Cstf2t T G 19: 31,083,295 L77R probably damaging Het
Drd3 C T 16: 43,817,103 R254W probably damaging Het
E2f1 C G 2: 154,564,022 G144R probably damaging Het
Fam103a1 C T 7: 81,767,647 R32C probably damaging Het
Fam187a C T 11: 102,885,849 P160S probably benign Het
Fam198a A T 9: 121,965,833 D351V probably damaging Het
Fat1 G A 8: 45,025,479 E2521K probably damaging Het
Fbln1 T A 15: 85,227,078 C144* probably null Het
Flii T C 11: 60,715,480 D1128G probably benign Het
Gata3 T A 2: 9,868,840 H281L probably benign Het
Gm20767 A T 13: 120,154,631 D2V possibly damaging Het
Iqsec3 C T 6: 121,376,255 A1135T probably benign Het
Irak4 T C 15: 94,561,595 I364T probably damaging Het
Mib2 A G 4: 155,655,284 F810S probably damaging Het
Nbn G A 4: 15,964,269 V115I probably damaging Het
Nfyc G T 4: 120,765,330 probably benign Het
Nup210 A T 6: 91,021,395 probably null Het
Olfr1057 C T 2: 86,374,915 V166I possibly damaging Het
Olfr123 T C 17: 37,796,232 S263P possibly damaging Het
Olfr330 C T 11: 58,529,690 A99T probably benign Het
Paqr8 A G 1: 20,935,632 T337A probably benign Het
Plce1 T C 19: 38,651,834 V508A probably benign Het
Prmt2 G T 10: 76,225,303 D116E probably benign Het
Prss51 T A 14: 64,096,175 probably benign Het
Prune2 T A 19: 17,125,454 V2659D probably benign Het
Ptpn3 C T 4: 57,270,144 R6H probably damaging Het
Rdh12 C T 12: 79,213,672 R181* probably null Het
Rsf1 T A 7: 97,662,152 D696E probably benign Het
Sh3rf2 C T 18: 42,111,308 R280C probably damaging Het
Slco6d1 T A 1: 98,499,777 I611K probably damaging Het
Spg7 G C 8: 123,087,373 R457P probably damaging Het
Swap70 T A 7: 110,267,881 W297R probably damaging Het
Tcaf3 T A 6: 42,589,804 I784F probably damaging Het
Tox2 T A 2: 163,314,323 I138N probably damaging Het
Trim54 A C 5: 31,134,144 E203A probably damaging Het
Vmn2r19 A T 6: 123,315,589 T197S possibly damaging Het
Vmn2r28 T A 7: 5,488,027 H407L probably damaging Het
Wdr19 G A 5: 65,224,726 V430M probably damaging Het
Other mutations in Snph
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01736:Snph APN 2 151594173 nonsense probably null
IGL02017:Snph APN 2 151600982 missense probably damaging 1.00
IGL02029:Snph APN 2 151593607 missense probably damaging 1.00
IGL02186:Snph APN 2 151594343 missense possibly damaging 0.67
R0621:Snph UTSW 2 151593722 missense probably damaging 1.00
R1311:Snph UTSW 2 151597202 missense probably damaging 1.00
R1660:Snph UTSW 2 151594478 nonsense probably null
R3923:Snph UTSW 2 151593511 missense probably damaging 1.00
R4081:Snph UTSW 2 151593802 missense probably damaging 1.00
R4082:Snph UTSW 2 151593802 missense probably damaging 1.00
R4461:Snph UTSW 2 151593847 missense probably benign 0.00
R4462:Snph UTSW 2 151594115 missense probably damaging 1.00
R4463:Snph UTSW 2 151594115 missense probably damaging 1.00
R4619:Snph UTSW 2 151594514 nonsense probably null
R5042:Snph UTSW 2 151601057 missense possibly damaging 0.66
R5180:Snph UTSW 2 151600387 missense probably benign 0.05
R5184:Snph UTSW 2 151594544 missense probably damaging 1.00
R5925:Snph UTSW 2 151594231 missense probably damaging 1.00
R7169:Snph UTSW 2 151594387 missense probably damaging 1.00
R7243:Snph UTSW 2 151594253 missense probably damaging 0.99
R7417:Snph UTSW 2 151600343 missense probably damaging 1.00
R7607:Snph UTSW 2 151594586 missense probably damaging 1.00
X0024:Snph UTSW 2 151594204 missense probably benign 0.37
Z1177:Snph UTSW 2 151593634 missense possibly damaging 0.47
Predicted Primers PCR Primer
(F):5'- TCTGAATCCCTGACACTATTGAC -3'
(R):5'- GGAACCCAAGAGTTACTGGAGC -3'

Sequencing Primer
(F):5'- CCTGACACTATTGACATCTTGGG -3'
(R):5'- AGTTACTGGAGCCGCCACTAC -3'
Posted On2015-03-18