Incidental Mutation 'R3753:Nbn'
ID271299
Institutional Source Beutler Lab
Gene Symbol Nbn
Ensembl Gene ENSMUSG00000028224
Gene Namenibrin
SynonymsNbs1
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3753 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location15957925-15992589 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 15964269 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 115 (V115I)
Ref Sequence ENSEMBL: ENSMUSP00000029879 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029879] [ENSMUST00000149069]
Predicted Effect probably damaging
Transcript: ENSMUST00000029879
AA Change: V115I

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000029879
Gene: ENSMUSG00000028224
AA Change: V115I

DomainStartEndE-ValueType
low complexity region 4 13 N/A INTRINSIC
FHA 23 83 2.27e-4 SMART
BRCT 103 184 6.37e0 SMART
Pfam:NIBRIN_BRCT_II 216 325 2.2e-34 PFAM
low complexity region 557 565 N/A INTRINSIC
Nbs1_C 680 744 2.14e-34 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000149069
AA Change: V115I

PolyPhen 2 Score 0.432 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000120829
Gene: ENSMUSG00000028224
AA Change: V115I

DomainStartEndE-ValueType
low complexity region 4 13 N/A INTRINSIC
FHA 23 83 2.27e-4 SMART
BRCT 103 184 6.37e0 SMART
PDB:2K2W|A 217 326 3e-32 PDB
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency 98% (49/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Mutations in this gene are associated with Nijmegen breakage syndrome, an autosomal recessive chromosomal instability syndrome characterized by microcephaly, growth retardation, immunodeficiency, and cancer predisposition. The encoded protein is a member of the MRE11/RAD50 double-strand break repair complex which consists of 5 proteins. This gene product is thought to be involved in DNA double-strand break repair and DNA damage-induced checkpoint activation. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous targeted mutations exhibit phenotypes ranging from impaired extraembryonic tissue growth and early embryonic death to growth retardation, lymphoid defects, lymphoma susceptibility, and failure of oogenesis. Null heterozygotes are cancer prone. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001J03Rik A T 5: 146,184,867 I74N probably damaging Het
Acp7 T A 7: 28,616,660 Y167F probably damaging Het
Acsl1 A T 8: 46,513,565 probably benign Het
Bcr T C 10: 75,135,940 V599A probably benign Het
Brd1 C T 15: 88,689,618 V1093I possibly damaging Het
Cep152 A G 2: 125,625,052 probably benign Het
Cstf2t T G 19: 31,083,295 L77R probably damaging Het
Drd3 C T 16: 43,817,103 R254W probably damaging Het
E2f1 C G 2: 154,564,022 G144R probably damaging Het
Fam103a1 C T 7: 81,767,647 R32C probably damaging Het
Fam187a C T 11: 102,885,849 P160S probably benign Het
Fam198a A T 9: 121,965,833 D351V probably damaging Het
Fat1 G A 8: 45,025,479 E2521K probably damaging Het
Fbln1 T A 15: 85,227,078 C144* probably null Het
Flii T C 11: 60,715,480 D1128G probably benign Het
Gata3 T A 2: 9,868,840 H281L probably benign Het
Gm20767 A T 13: 120,154,631 D2V possibly damaging Het
Iqsec3 C T 6: 121,376,255 A1135T probably benign Het
Irak4 T C 15: 94,561,595 I364T probably damaging Het
Mib2 A G 4: 155,655,284 F810S probably damaging Het
Nfyc G T 4: 120,765,330 probably benign Het
Nup210 A T 6: 91,021,395 probably null Het
Olfr1057 C T 2: 86,374,915 V166I possibly damaging Het
Olfr123 T C 17: 37,796,232 S263P possibly damaging Het
Olfr330 C T 11: 58,529,690 A99T probably benign Het
Paqr8 A G 1: 20,935,632 T337A probably benign Het
Plce1 T C 19: 38,651,834 V508A probably benign Het
Prmt2 G T 10: 76,225,303 D116E probably benign Het
Prss51 T A 14: 64,096,175 probably benign Het
Prune2 T A 19: 17,125,454 V2659D probably benign Het
Ptpn3 C T 4: 57,270,144 R6H probably damaging Het
Rdh12 C T 12: 79,213,672 R181* probably null Het
Rsf1 T A 7: 97,662,152 D696E probably benign Het
Sh3rf2 C T 18: 42,111,308 R280C probably damaging Het
Slco6d1 T A 1: 98,499,777 I611K probably damaging Het
Snph G A 2: 151,593,454 P449L probably benign Het
Spg7 G C 8: 123,087,373 R457P probably damaging Het
Swap70 T A 7: 110,267,881 W297R probably damaging Het
Tcaf3 T A 6: 42,589,804 I784F probably damaging Het
Tox2 T A 2: 163,314,323 I138N probably damaging Het
Trim54 A C 5: 31,134,144 E203A probably damaging Het
Vmn2r19 A T 6: 123,315,589 T197S possibly damaging Het
Vmn2r28 T A 7: 5,488,027 H407L probably damaging Het
Wdr19 G A 5: 65,224,726 V430M probably damaging Het
Other mutations in Nbn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00833:Nbn APN 4 15964320 missense probably benign 0.01
IGL00921:Nbn APN 4 15963833 missense possibly damaging 0.85
IGL01621:Nbn APN 4 15965221 missense probably benign 0.45
IGL02372:Nbn APN 4 15986613 missense probably benign 0.00
IGL03392:Nbn APN 4 15962362 missense probably damaging 1.00
R0238:Nbn UTSW 4 15986672 splice site probably benign
R0244:Nbn UTSW 4 15979353 missense probably benign 0.00
R0432:Nbn UTSW 4 15983951 unclassified probably benign
R0946:Nbn UTSW 4 15970719 critical splice acceptor site probably null
R1076:Nbn UTSW 4 15970719 critical splice acceptor site probably null
R1563:Nbn UTSW 4 15981668 missense possibly damaging 0.77
R1579:Nbn UTSW 4 15964289 missense probably damaging 0.99
R1660:Nbn UTSW 4 15971771 missense probably benign 0.06
R1663:Nbn UTSW 4 15970903 missense probably benign 0.13
R2005:Nbn UTSW 4 15979351 missense probably benign 0.01
R2010:Nbn UTSW 4 15969393 missense probably damaging 1.00
R2077:Nbn UTSW 4 15979389 missense probably damaging 1.00
R2228:Nbn UTSW 4 15970904 missense probably benign 0.01
R2229:Nbn UTSW 4 15970904 missense probably benign 0.01
R2356:Nbn UTSW 4 15970863 missense probably damaging 0.96
R2869:Nbn UTSW 4 15963810 missense probably damaging 1.00
R2869:Nbn UTSW 4 15963810 missense probably damaging 1.00
R3508:Nbn UTSW 4 15962387 missense probably damaging 1.00
R3745:Nbn UTSW 4 15976163 missense possibly damaging 0.67
R4756:Nbn UTSW 4 15981470 missense probably benign 0.06
R5042:Nbn UTSW 4 15981446 missense probably benign 0.10
R5177:Nbn UTSW 4 15965132 critical splice acceptor site probably null
R5229:Nbn UTSW 4 15963893 missense probably damaging 0.98
R5368:Nbn UTSW 4 15969391 missense probably damaging 1.00
R5431:Nbn UTSW 4 15986593 missense probably benign
R6025:Nbn UTSW 4 15981347 missense probably damaging 0.97
R6375:Nbn UTSW 4 15979327 missense probably benign
R6543:Nbn UTSW 4 15986605 missense probably benign 0.39
R6655:Nbn UTSW 4 15981696 missense probably damaging 0.98
R6965:Nbn UTSW 4 15970863 missense probably benign 0.25
R7090:Nbn UTSW 4 15981350 missense probably benign 0.06
R7159:Nbn UTSW 4 15983677 intron probably null
R7241:Nbn UTSW 4 15991190 missense probably benign 0.00
R7267:Nbn UTSW 4 15979320 missense probably benign 0.00
R7597:Nbn UTSW 4 15963911 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACTCAGCTTGTTTGGGTCC -3'
(R):5'- GACGGAACTTGATCTGAACACAG -3'

Sequencing Primer
(F):5'- GGGTCCTCATTGGTTACATTGTCAC -3'
(R):5'- CTTGATCTGAACACAGAGACTTTC -3'
Posted On2015-03-18