Incidental Mutation 'R3753:Nfyc'
ID271302
Institutional Source Beutler Lab
Gene Symbol Nfyc
Ensembl Gene ENSMUSG00000032897
Gene Namenuclear transcription factor-Y gamma
Synonyms
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.966) question?
Stock #R3753 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location120757438-120831572 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) G to T at 120765330 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000117646 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043429] [ENSMUST00000097906] [ENSMUST00000118902] [ENSMUST00000120779] [ENSMUST00000134979] [ENSMUST00000136236]
Predicted Effect unknown
Transcript: ENSMUST00000043429
AA Change: Q202K
SMART Domains Protein: ENSMUSP00000047441
Gene: ENSMUSG00000032897
AA Change: Q202K

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
Pfam:Histone 36 107 2.5e-13 PFAM
Pfam:CBFD_NFYB_HMF 41 105 4.5e-23 PFAM
low complexity region 150 190 N/A INTRINSIC
low complexity region 193 231 N/A INTRINSIC
low complexity region 275 297 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000083556
Predicted Effect unknown
Transcript: ENSMUST00000097906
AA Change: Q202K
SMART Domains Protein: ENSMUSP00000095516
Gene: ENSMUSG00000032897
AA Change: Q202K

DomainStartEndE-ValueType
Pfam:Histone 9 107 7.2e-17 PFAM
Pfam:CBFD_NFYB_HMF 41 105 7.8e-23 PFAM
low complexity region 150 190 N/A INTRINSIC
low complexity region 193 231 N/A INTRINSIC
low complexity region 275 297 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000118902
AA Change: Q202K
SMART Domains Protein: ENSMUSP00000112610
Gene: ENSMUSG00000032897
AA Change: Q202K

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
Pfam:Histone 36 107 2.5e-13 PFAM
Pfam:CBFD_NFYB_HMF 41 105 4.5e-23 PFAM
low complexity region 150 190 N/A INTRINSIC
low complexity region 193 231 N/A INTRINSIC
low complexity region 275 297 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000120779
AA Change: Q202K
SMART Domains Protein: ENSMUSP00000112810
Gene: ENSMUSG00000032897
AA Change: Q202K

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
Pfam:Histone 36 107 2.5e-13 PFAM
Pfam:CBFD_NFYB_HMF 41 105 4.5e-23 PFAM
low complexity region 150 190 N/A INTRINSIC
low complexity region 193 231 N/A INTRINSIC
low complexity region 275 297 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127030
Predicted Effect unknown
Transcript: ENSMUST00000134979
AA Change: Q140K
SMART Domains Protein: ENSMUSP00000114640
Gene: ENSMUSG00000032897
AA Change: Q140K

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
PDB:1N1J|B 23 58 8e-9 PDB
low complexity region 88 128 N/A INTRINSIC
low complexity region 132 163 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000136236
SMART Domains Protein: ENSMUSP00000117646
Gene: ENSMUSG00000032897

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
Pfam:CBFD_NFYB_HMF 41 70 5.1e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145029
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148081
Meta Mutation Damage Score 0.3100 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency 98% (49/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one subunit of a trimeric complex forming a highly conserved transcription factor that binds with high specificity to CCAAT motifs in the promoters of a variety of genes. The encoded protein, subunit C, forms a tight dimer with the B subunit, a prerequisite for subunit A association. The resulting trimer binds to DNA with high specificity and affinity. Subunits B and C each contain a histone-like motif. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2008]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001J03Rik A T 5: 146,184,867 I74N probably damaging Het
Acp7 T A 7: 28,616,660 Y167F probably damaging Het
Acsl1 A T 8: 46,513,565 probably benign Het
Bcr T C 10: 75,135,940 V599A probably benign Het
Brd1 C T 15: 88,689,618 V1093I possibly damaging Het
Cep152 A G 2: 125,625,052 probably benign Het
Cstf2t T G 19: 31,083,295 L77R probably damaging Het
Drd3 C T 16: 43,817,103 R254W probably damaging Het
E2f1 C G 2: 154,564,022 G144R probably damaging Het
Fam103a1 C T 7: 81,767,647 R32C probably damaging Het
Fam187a C T 11: 102,885,849 P160S probably benign Het
Fam198a A T 9: 121,965,833 D351V probably damaging Het
Fat1 G A 8: 45,025,479 E2521K probably damaging Het
Fbln1 T A 15: 85,227,078 C144* probably null Het
Flii T C 11: 60,715,480 D1128G probably benign Het
Gata3 T A 2: 9,868,840 H281L probably benign Het
Gm20767 A T 13: 120,154,631 D2V possibly damaging Het
Iqsec3 C T 6: 121,376,255 A1135T probably benign Het
Irak4 T C 15: 94,561,595 I364T probably damaging Het
Mib2 A G 4: 155,655,284 F810S probably damaging Het
Nbn G A 4: 15,964,269 V115I probably damaging Het
Nup210 A T 6: 91,021,395 probably null Het
Olfr1057 C T 2: 86,374,915 V166I possibly damaging Het
Olfr123 T C 17: 37,796,232 S263P possibly damaging Het
Olfr330 C T 11: 58,529,690 A99T probably benign Het
Paqr8 A G 1: 20,935,632 T337A probably benign Het
Plce1 T C 19: 38,651,834 V508A probably benign Het
Prmt2 G T 10: 76,225,303 D116E probably benign Het
Prss51 T A 14: 64,096,175 probably benign Het
Prune2 T A 19: 17,125,454 V2659D probably benign Het
Ptpn3 C T 4: 57,270,144 R6H probably damaging Het
Rdh12 C T 12: 79,213,672 R181* probably null Het
Rsf1 T A 7: 97,662,152 D696E probably benign Het
Sh3rf2 C T 18: 42,111,308 R280C probably damaging Het
Slco6d1 T A 1: 98,499,777 I611K probably damaging Het
Snph G A 2: 151,593,454 P449L probably benign Het
Spg7 G C 8: 123,087,373 R457P probably damaging Het
Swap70 T A 7: 110,267,881 W297R probably damaging Het
Tcaf3 T A 6: 42,589,804 I784F probably damaging Het
Tox2 T A 2: 163,314,323 I138N probably damaging Het
Trim54 A C 5: 31,134,144 E203A probably damaging Het
Vmn2r19 A T 6: 123,315,589 T197S possibly damaging Het
Vmn2r28 T A 7: 5,488,027 H407L probably damaging Het
Wdr19 G A 5: 65,224,726 V430M probably damaging Het
Other mutations in Nfyc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00837:Nfyc APN 4 120781547 intron probably benign
IGL01522:Nfyc APN 4 120781524 missense probably damaging 1.00
IGL01673:Nfyc APN 4 120779110 unclassified probably benign
IGL03197:Nfyc APN 4 120773761 missense probably damaging 1.00
PIT4378001:Nfyc UTSW 4 120790491 critical splice acceptor site probably null
R0638:Nfyc UTSW 4 120768884 missense probably benign 0.19
R0725:Nfyc UTSW 4 120768734 unclassified probably benign
R0842:Nfyc UTSW 4 120759377 missense probably benign 0.16
R1480:Nfyc UTSW 4 120768724 critical splice donor site probably null
R1535:Nfyc UTSW 4 120761724 missense probably damaging 0.99
R1940:Nfyc UTSW 4 120773664 splice site probably benign
R5605:Nfyc UTSW 4 120790489 splice site probably benign
R6047:Nfyc UTSW 4 120779117 splice site probably null
R7545:Nfyc UTSW 4 120773769 critical splice acceptor site probably null
Z1176:Nfyc UTSW 4 120790487 splice site probably benign
Z1177:Nfyc UTSW 4 120790466 missense unknown
Predicted Primers PCR Primer
(F):5'- CCTGGACTGAAGCAGAGTAG -3'
(R):5'- GTACAACCATTGGGCTGCATG -3'

Sequencing Primer
(F):5'- TGTGTAATGGGAATACTGACACC -3'
(R):5'- CAACCATTGGGCTGCATGTTAAG -3'
Posted On2015-03-18