Incidental Mutation 'R3753:Mib2'
ID271303
Institutional Source Beutler Lab
Gene Symbol Mib2
Ensembl Gene ENSMUSG00000029060
Gene Namemindbomb E3 ubiquitin protein ligase 2
Synonyms2210008I11Rik, Zzank1
Accession Numbers

Ncbi RefSeq: NM_001256107.1, NM_145124.3, NM_001256108.2; MGI:2679684

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3753 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location155654677-155669198 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 155655284 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 810 (F810S)
Ref Sequence ENSEMBL: ENSMUSP00000099465 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030937] [ENSMUST00000103176] [ENSMUST00000141108]
Predicted Effect probably benign
Transcript: ENSMUST00000030937
SMART Domains Protein: ENSMUSP00000030937
Gene: ENSMUSG00000029061

DomainStartEndE-ValueType
low complexity region 19 41 N/A INTRINSIC
ZnMc 85 256 8.39e-48 SMART
ShKT 255 291 4.06e-10 SMART
IG 307 390 4.53e-2 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000103176
AA Change: F810S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099465
Gene: ENSMUSG00000029060
AA Change: F810S

DomainStartEndE-ValueType
Pfam:MIB_HERC2 12 78 3.4e-26 PFAM
ZnF_ZZ 85 130 6.44e-9 SMART
Pfam:MIB_HERC2 160 225 4.2e-26 PFAM
Blast:ANK 285 320 2e-13 BLAST
ANK 428 457 8.52e-4 SMART
ANK 461 490 6.71e-2 SMART
ANK 494 523 9.93e-5 SMART
ANK 527 559 1.1e2 SMART
ANK 563 593 9.21e0 SMART
ANK 597 627 3.57e-6 SMART
ANK 631 660 3.31e-1 SMART
ANK 664 709 1.73e3 SMART
Blast:ANK 733 762 9e-10 BLAST
low complexity region 763 772 N/A INTRINSIC
RING 798 832 2.55e-1 SMART
RING 877 909 1.81e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128204
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130237
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130944
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139134
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139242
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139788
Predicted Effect probably benign
Transcript: ENSMUST00000141108
SMART Domains Protein: ENSMUSP00000122269
Gene: ENSMUSG00000029060

DomainStartEndE-ValueType
Pfam:MIB_HERC2 1 52 7.1e-17 PFAM
internal_repeat_1 82 150 7.77e-12 PROSPERO
internal_repeat_1 153 220 7.77e-12 PROSPERO
ANK 289 318 8.52e-4 SMART
ANK 322 351 6.71e-2 SMART
Pfam:Ank 356 375 2.9e-4 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151843
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156906
Meta Mutation Damage Score 0.2813 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency 98% (49/50)
MGI Phenotype Strain: 3652500; 3804450
PHENOTYPE: Mice homozygous for a knock-out allele display exencephaly with a variable penetrance that depends on the genetic background. Mice homozygous for a reporter/null allele are viable, fertile and show normal growth, body weight and brain morphology. [provided by MGI curators]
Allele List at MGI

All alleles(16) : Targeted(5) Gene trapped(11)

Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001J03Rik A T 5: 146,184,867 I74N probably damaging Het
Acp7 T A 7: 28,616,660 Y167F probably damaging Het
Acsl1 A T 8: 46,513,565 probably benign Het
Bcr T C 10: 75,135,940 V599A probably benign Het
Brd1 C T 15: 88,689,618 V1093I possibly damaging Het
Cep152 A G 2: 125,625,052 probably benign Het
Cstf2t T G 19: 31,083,295 L77R probably damaging Het
Drd3 C T 16: 43,817,103 R254W probably damaging Het
E2f1 C G 2: 154,564,022 G144R probably damaging Het
Fam103a1 C T 7: 81,767,647 R32C probably damaging Het
Fam187a C T 11: 102,885,849 P160S probably benign Het
Fam198a A T 9: 121,965,833 D351V probably damaging Het
Fat1 G A 8: 45,025,479 E2521K probably damaging Het
Fbln1 T A 15: 85,227,078 C144* probably null Het
Flii T C 11: 60,715,480 D1128G probably benign Het
Gata3 T A 2: 9,868,840 H281L probably benign Het
Gm20767 A T 13: 120,154,631 D2V possibly damaging Het
Iqsec3 C T 6: 121,376,255 A1135T probably benign Het
Irak4 T C 15: 94,561,595 I364T probably damaging Het
Nbn G A 4: 15,964,269 V115I probably damaging Het
Nfyc G T 4: 120,765,330 probably benign Het
Nup210 A T 6: 91,021,395 probably null Het
Olfr1057 C T 2: 86,374,915 V166I possibly damaging Het
Olfr123 T C 17: 37,796,232 S263P possibly damaging Het
Olfr330 C T 11: 58,529,690 A99T probably benign Het
Paqr8 A G 1: 20,935,632 T337A probably benign Het
Plce1 T C 19: 38,651,834 V508A probably benign Het
Prmt2 G T 10: 76,225,303 D116E probably benign Het
Prss51 T A 14: 64,096,175 probably benign Het
Prune2 T A 19: 17,125,454 V2659D probably benign Het
Ptpn3 C T 4: 57,270,144 R6H probably damaging Het
Rdh12 C T 12: 79,213,672 R181* probably null Het
Rsf1 T A 7: 97,662,152 D696E probably benign Het
Sh3rf2 C T 18: 42,111,308 R280C probably damaging Het
Slco6d1 T A 1: 98,499,777 I611K probably damaging Het
Snph G A 2: 151,593,454 P449L probably benign Het
Spg7 G C 8: 123,087,373 R457P probably damaging Het
Swap70 T A 7: 110,267,881 W297R probably damaging Het
Tcaf3 T A 6: 42,589,804 I784F probably damaging Het
Tox2 T A 2: 163,314,323 I138N probably damaging Het
Trim54 A C 5: 31,134,144 E203A probably damaging Het
Vmn2r19 A T 6: 123,315,589 T197S possibly damaging Het
Vmn2r28 T A 7: 5,488,027 H407L probably damaging Het
Wdr19 G A 5: 65,224,726 V430M probably damaging Het
Other mutations in Mib2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01014:Mib2 APN 4 155657730 missense probably damaging 1.00
IGL01404:Mib2 APN 4 155654936 missense probably damaging 1.00
IGL01819:Mib2 APN 4 155655258 unclassified probably null
IGL02147:Mib2 APN 4 155657687 missense probably benign
IGL02260:Mib2 APN 4 155661171 missense probably damaging 1.00
IGL02472:Mib2 APN 4 155656746 missense probably damaging 1.00
IGL02632:Mib2 APN 4 155655579 missense probably damaging 0.98
IGL03051:Mib2 APN 4 155657290 missense probably damaging 1.00
IGL03077:Mib2 APN 4 155659443 missense probably benign 0.01
R0042:Mib2 UTSW 4 155659440 nonsense probably null
R0042:Mib2 UTSW 4 155659440 nonsense probably null
R0115:Mib2 UTSW 4 155656062 unclassified probably benign
R0193:Mib2 UTSW 4 155655673 missense probably benign
R0279:Mib2 UTSW 4 155661216 missense possibly damaging 0.89
R0373:Mib2 UTSW 4 155656288 missense probably damaging 1.00
R0481:Mib2 UTSW 4 155656062 unclassified probably benign
R0563:Mib2 UTSW 4 155659460 missense probably damaging 1.00
R0564:Mib2 UTSW 4 155659460 missense probably damaging 1.00
R0625:Mib2 UTSW 4 155659460 missense probably damaging 1.00
R0714:Mib2 UTSW 4 155659460 missense probably damaging 1.00
R0740:Mib2 UTSW 4 155659460 missense probably damaging 1.00
R0942:Mib2 UTSW 4 155659460 missense probably damaging 1.00
R0987:Mib2 UTSW 4 155659460 missense probably damaging 1.00
R1023:Mib2 UTSW 4 155659460 missense probably damaging 1.00
R1033:Mib2 UTSW 4 155659460 missense probably damaging 1.00
R1037:Mib2 UTSW 4 155659460 missense probably damaging 1.00
R1460:Mib2 UTSW 4 155659460 missense probably damaging 1.00
R1481:Mib2 UTSW 4 155656999 missense probably benign 0.01
R1712:Mib2 UTSW 4 155654799 missense probably damaging 1.00
R2015:Mib2 UTSW 4 155657880 missense probably damaging 1.00
R2072:Mib2 UTSW 4 155659701 missense probably damaging 0.99
R2131:Mib2 UTSW 4 155655238 unclassified probably null
R2187:Mib2 UTSW 4 155654933 missense possibly damaging 0.95
R3751:Mib2 UTSW 4 155655284 missense probably damaging 1.00
R3752:Mib2 UTSW 4 155655284 missense probably damaging 1.00
R4381:Mib2 UTSW 4 155657612 missense possibly damaging 0.55
R4584:Mib2 UTSW 4 155657287 missense probably damaging 1.00
R4669:Mib2 UTSW 4 155657415 missense possibly damaging 0.49
R4754:Mib2 UTSW 4 155655365 missense possibly damaging 0.90
R4782:Mib2 UTSW 4 155659772 missense probably benign 0.00
R4799:Mib2 UTSW 4 155659772 missense probably benign 0.00
R5036:Mib2 UTSW 4 155656288 missense probably damaging 1.00
R5073:Mib2 UTSW 4 155656776 missense probably damaging 1.00
R5915:Mib2 UTSW 4 155656051 unclassified probably benign
R6695:Mib2 UTSW 4 155661172 missense probably damaging 1.00
R7039:Mib2 UTSW 4 155659701 missense probably damaging 0.99
R7234:Mib2 UTSW 4 155657893 missense probably damaging 1.00
R7582:Mib2 UTSW 4 155654810 missense probably benign
X0012:Mib2 UTSW 4 155655395 unclassified probably null
Z1176:Mib2 UTSW 4 155661141 missense probably benign 0.06
Z1177:Mib2 UTSW 4 155655521 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TTCTTGCTGATGACCACCTG -3'
(R):5'- CCATGATGGAGGGCTTGTAG -3'

Sequencing Primer
(F):5'- TGATGACCACCTGGCACCTG -3'
(R):5'- CAACCATTAAGGCCATTGGG -3'
Posted On2015-03-18