Incidental Mutation 'R3753:Trim54'
ID271304
Institutional Source Beutler Lab
Gene Symbol Trim54
Ensembl Gene ENSMUSG00000062077
Gene Nametripartite motif-containing 54
SynonymsRnf30, 4930566I02Rik, MuRF3, 4930486E09Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3753 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location31116712-31137630 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 31134144 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Alanine at position 203 (E203A)
Ref Sequence ENSEMBL: ENSMUSP00000144629 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000013771] [ENSMUST00000043475] [ENSMUST00000201184] [ENSMUST00000202769]
Predicted Effect possibly damaging
Transcript: ENSMUST00000013771
AA Change: E203A

PolyPhen 2 Score 0.844 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000013771
Gene: ENSMUSG00000062077
AA Change: E203A

DomainStartEndE-ValueType
RING 26 81 8.61e-9 SMART
BBOX 121 163 1.23e-4 SMART
Blast:BBC 170 295 1e-27 BLAST
low complexity region 331 348 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000043475
SMART Domains Protein: ENSMUSP00000035321
Gene: ENSMUSG00000038676

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
low complexity region 56 62 N/A INTRINSIC
CRF 81 119 4.02e-15 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000201184
SMART Domains Protein: ENSMUSP00000144390
Gene: ENSMUSG00000038676

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
low complexity region 56 62 N/A INTRINSIC
CRF 81 119 4.02e-15 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201750
Predicted Effect probably damaging
Transcript: ENSMUST00000202769
AA Change: E203A

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000144629
Gene: ENSMUSG00000062077
AA Change: E203A

DomainStartEndE-ValueType
RING 26 81 8.61e-9 SMART
BBOX 121 163 1.23e-4 SMART
Blast:BBC 170 295 1e-27 BLAST
low complexity region 331 348 N/A INTRINSIC
Meta Mutation Damage Score 0.3289 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency 98% (49/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains a RING finger motif and is highly similar to the ring finger proteins RNF28/MURF1 and RNF29/MURF2. In vitro studies demonstrated that this protein, RNF28, and RNF29 form heterodimers, which may be important for the regulation of titin kinase and microtubule-dependent signal pathways in striated muscles. Alternatively spliced transcript variants encoding distinct isoforms have been reported. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal cardiac function but are prone to cardiac rupture after acute myocardial infarction. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001J03Rik A T 5: 146,184,867 I74N probably damaging Het
Acp7 T A 7: 28,616,660 Y167F probably damaging Het
Acsl1 A T 8: 46,513,565 probably benign Het
Bcr T C 10: 75,135,940 V599A probably benign Het
Brd1 C T 15: 88,689,618 V1093I possibly damaging Het
Cep152 A G 2: 125,625,052 probably benign Het
Cstf2t T G 19: 31,083,295 L77R probably damaging Het
Drd3 C T 16: 43,817,103 R254W probably damaging Het
E2f1 C G 2: 154,564,022 G144R probably damaging Het
Fam103a1 C T 7: 81,767,647 R32C probably damaging Het
Fam187a C T 11: 102,885,849 P160S probably benign Het
Fam198a A T 9: 121,965,833 D351V probably damaging Het
Fat1 G A 8: 45,025,479 E2521K probably damaging Het
Fbln1 T A 15: 85,227,078 C144* probably null Het
Flii T C 11: 60,715,480 D1128G probably benign Het
Gata3 T A 2: 9,868,840 H281L probably benign Het
Gm20767 A T 13: 120,154,631 D2V possibly damaging Het
Iqsec3 C T 6: 121,376,255 A1135T probably benign Het
Irak4 T C 15: 94,561,595 I364T probably damaging Het
Mib2 A G 4: 155,655,284 F810S probably damaging Het
Nbn G A 4: 15,964,269 V115I probably damaging Het
Nfyc G T 4: 120,765,330 probably benign Het
Nup210 A T 6: 91,021,395 probably null Het
Olfr1057 C T 2: 86,374,915 V166I possibly damaging Het
Olfr123 T C 17: 37,796,232 S263P possibly damaging Het
Olfr330 C T 11: 58,529,690 A99T probably benign Het
Paqr8 A G 1: 20,935,632 T337A probably benign Het
Plce1 T C 19: 38,651,834 V508A probably benign Het
Prmt2 G T 10: 76,225,303 D116E probably benign Het
Prss51 T A 14: 64,096,175 probably benign Het
Prune2 T A 19: 17,125,454 V2659D probably benign Het
Ptpn3 C T 4: 57,270,144 R6H probably damaging Het
Rdh12 C T 12: 79,213,672 R181* probably null Het
Rsf1 T A 7: 97,662,152 D696E probably benign Het
Sh3rf2 C T 18: 42,111,308 R280C probably damaging Het
Slco6d1 T A 1: 98,499,777 I611K probably damaging Het
Snph G A 2: 151,593,454 P449L probably benign Het
Spg7 G C 8: 123,087,373 R457P probably damaging Het
Swap70 T A 7: 110,267,881 W297R probably damaging Het
Tcaf3 T A 6: 42,589,804 I784F probably damaging Het
Tox2 T A 2: 163,314,323 I138N probably damaging Het
Vmn2r19 A T 6: 123,315,589 T197S possibly damaging Het
Vmn2r28 T A 7: 5,488,027 H407L probably damaging Het
Wdr19 G A 5: 65,224,726 V430M probably damaging Het
Other mutations in Trim54
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01012:Trim54 APN 5 31136958 missense probably benign 0.00
IGL02393:Trim54 APN 5 31131980 splice site probably benign
IGL02545:Trim54 APN 5 31132165 splice site probably benign
IGL02664:Trim54 APN 5 31136047 missense probably damaging 1.00
IGL03012:Trim54 APN 5 31137145 missense probably benign
IGL03160:Trim54 APN 5 31132080 missense probably damaging 0.96
R0238:Trim54 UTSW 5 31134119 missense probably benign 0.18
R0238:Trim54 UTSW 5 31134119 missense probably benign 0.18
R0617:Trim54 UTSW 5 31136182 unclassified probably null
R3624:Trim54 UTSW 5 31136976 missense possibly damaging 0.91
R6815:Trim54 UTSW 5 31134080 missense probably damaging 1.00
R7350:Trim54 UTSW 5 31137161 missense probably benign
R7575:Trim54 UTSW 5 31134087 missense possibly damaging 0.55
X0028:Trim54 UTSW 5 31117078 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- GTGTCTAGAGAGTGTCACCTCC -3'
(R):5'- AGTGTAACTTGACCGACATTACG -3'

Sequencing Primer
(F):5'- TGCAGATGTCCCCAATGATCGAG -3'
(R):5'- CGACATTACGGAGTTGCTGTG -3'
Posted On2015-03-18