Incidental Mutation 'R3753:Nup210'
ID271308
Institutional Source Beutler Lab
Gene Symbol Nup210
Ensembl Gene ENSMUSG00000030091
Gene Namenucleoporin 210
Synonymsgp190, Pom210, gp210
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3753 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location91013068-91116829 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to T at 91021395 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000120098 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032179] [ENSMUST00000113509] [ENSMUST00000142951]
Predicted Effect probably null
Transcript: ENSMUST00000032179
SMART Domains Protein: ENSMUSP00000032179
Gene: ENSMUSG00000030091

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Blast:BID_2 450 527 3e-29 BLAST
low complexity region 850 862 N/A INTRINSIC
Blast:S1 937 1022 6e-37 BLAST
BID_2 1077 1152 8.36e-6 SMART
low complexity region 1159 1168 N/A INTRINSIC
Blast:BID_2 1468 1551 3e-35 BLAST
transmembrane domain 1809 1831 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000113509
SMART Domains Protein: ENSMUSP00000109137
Gene: ENSMUSG00000030091

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Blast:BID_2 450 527 4e-29 BLAST
low complexity region 806 818 N/A INTRINSIC
Blast:S1 893 978 4e-37 BLAST
BID_2 1033 1108 8.36e-6 SMART
low complexity region 1115 1124 N/A INTRINSIC
Blast:BID_2 1424 1507 3e-35 BLAST
transmembrane domain 1765 1787 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123340
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141952
Predicted Effect probably null
Transcript: ENSMUST00000142951
SMART Domains Protein: ENSMUSP00000120098
Gene: ENSMUSG00000030091

DomainStartEndE-ValueType
low complexity region 63 75 N/A INTRINSIC
Blast:S1 150 235 3e-37 BLAST
BID_2 290 365 8.36e-6 SMART
low complexity region 372 381 N/A INTRINSIC
Blast:BID_2 681 764 1e-35 BLAST
transmembrane domain 1022 1044 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148397
Meta Mutation Damage Score 0.9589 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency 98% (49/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The nuclear pore complex is a massive structure that extends across the nuclear envelope, forming a gateway that regulates the flow of macromolecules between the nucleus and the cytoplasm. Nucleoporins are the main components of the nuclear pore complex in eukaryotic cells. The protein encoded by this gene is a membrane-spanning glycoprotein that is a major component of the nuclear pore complex. Multiple pseudogenes related to this gene are located on chromosome 3. [provided by RefSeq, Jul 2013]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001J03Rik A T 5: 146,184,867 I74N probably damaging Het
Acp7 T A 7: 28,616,660 Y167F probably damaging Het
Acsl1 A T 8: 46,513,565 probably benign Het
Bcr T C 10: 75,135,940 V599A probably benign Het
Brd1 C T 15: 88,689,618 V1093I possibly damaging Het
Cep152 A G 2: 125,625,052 probably benign Het
Cstf2t T G 19: 31,083,295 L77R probably damaging Het
Drd3 C T 16: 43,817,103 R254W probably damaging Het
E2f1 C G 2: 154,564,022 G144R probably damaging Het
Fam103a1 C T 7: 81,767,647 R32C probably damaging Het
Fam187a C T 11: 102,885,849 P160S probably benign Het
Fam198a A T 9: 121,965,833 D351V probably damaging Het
Fat1 G A 8: 45,025,479 E2521K probably damaging Het
Fbln1 T A 15: 85,227,078 C144* probably null Het
Flii T C 11: 60,715,480 D1128G probably benign Het
Gata3 T A 2: 9,868,840 H281L probably benign Het
Gm20767 A T 13: 120,154,631 D2V possibly damaging Het
Iqsec3 C T 6: 121,376,255 A1135T probably benign Het
Irak4 T C 15: 94,561,595 I364T probably damaging Het
Mib2 A G 4: 155,655,284 F810S probably damaging Het
Nbn G A 4: 15,964,269 V115I probably damaging Het
Nfyc G T 4: 120,765,330 probably benign Het
Olfr1057 C T 2: 86,374,915 V166I possibly damaging Het
Olfr123 T C 17: 37,796,232 S263P possibly damaging Het
Olfr330 C T 11: 58,529,690 A99T probably benign Het
Paqr8 A G 1: 20,935,632 T337A probably benign Het
Plce1 T C 19: 38,651,834 V508A probably benign Het
Prmt2 G T 10: 76,225,303 D116E probably benign Het
Prss51 T A 14: 64,096,175 probably benign Het
Prune2 T A 19: 17,125,454 V2659D probably benign Het
Ptpn3 C T 4: 57,270,144 R6H probably damaging Het
Rdh12 C T 12: 79,213,672 R181* probably null Het
Rsf1 T A 7: 97,662,152 D696E probably benign Het
Sh3rf2 C T 18: 42,111,308 R280C probably damaging Het
Slco6d1 T A 1: 98,499,777 I611K probably damaging Het
Snph G A 2: 151,593,454 P449L probably benign Het
Spg7 G C 8: 123,087,373 R457P probably damaging Het
Swap70 T A 7: 110,267,881 W297R probably damaging Het
Tcaf3 T A 6: 42,589,804 I784F probably damaging Het
Tox2 T A 2: 163,314,323 I138N probably damaging Het
Trim54 A C 5: 31,134,144 E203A probably damaging Het
Vmn2r19 A T 6: 123,315,589 T197S possibly damaging Het
Vmn2r28 T A 7: 5,488,027 H407L probably damaging Het
Wdr19 G A 5: 65,224,726 V430M probably damaging Het
Other mutations in Nup210
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01139:Nup210 APN 6 91030097 missense possibly damaging 0.92
IGL01532:Nup210 APN 6 91085999 splice site probably benign
IGL01574:Nup210 APN 6 91040564 missense probably benign 0.35
IGL01621:Nup210 APN 6 91030117 missense probably damaging 1.00
IGL01976:Nup210 APN 6 91053614 missense possibly damaging 0.89
IGL02089:Nup210 APN 6 91076698 missense probably benign 0.04
IGL02291:Nup210 APN 6 91101268 missense probably damaging 1.00
IGL03013:Nup210 APN 6 91053379 missense probably benign 0.00
IGL03046:Nup210 APN 6 91018996 splice site probably benign
IGL03136:Nup210 APN 6 91028861 missense probably benign 0.32
IGL03139:Nup210 APN 6 91020239 missense probably benign 0.08
IGL03195:Nup210 APN 6 91015850 missense probably benign 0.32
IGL03344:Nup210 APN 6 91021429 missense possibly damaging 0.53
brotherhood UTSW 6 91036469 missense possibly damaging 0.81
equality UTSW 6 91021395 critical splice donor site probably null
Liberty UTSW 6 91020180 missense probably benign 0.04
unity UTSW 6 91031668 nonsense probably null
IGL03134:Nup210 UTSW 6 91030190 missense probably damaging 0.99
PIT4810001:Nup210 UTSW 6 91030124 missense probably damaging 1.00
R0100:Nup210 UTSW 6 91069193 missense probably benign 0.04
R0348:Nup210 UTSW 6 91074310 missense probably benign 0.27
R0385:Nup210 UTSW 6 91028795 missense possibly damaging 0.77
R0551:Nup210 UTSW 6 91021484 missense possibly damaging 0.85
R0606:Nup210 UTSW 6 91026929 missense possibly damaging 0.89
R1053:Nup210 UTSW 6 91028811 missense probably benign 0.41
R1301:Nup210 UTSW 6 91042347 missense possibly damaging 0.47
R1381:Nup210 UTSW 6 91075960 missense probably damaging 0.99
R1464:Nup210 UTSW 6 91053569 missense possibly damaging 0.82
R1464:Nup210 UTSW 6 91053569 missense possibly damaging 0.82
R1487:Nup210 UTSW 6 91042576 missense probably damaging 1.00
R1522:Nup210 UTSW 6 91069166 missense possibly damaging 0.85
R1529:Nup210 UTSW 6 91036376 missense probably damaging 1.00
R1531:Nup210 UTSW 6 91034841 missense probably benign 0.05
R1668:Nup210 UTSW 6 91028805 missense possibly damaging 0.89
R1694:Nup210 UTSW 6 91062803 missense probably benign 0.09
R1803:Nup210 UTSW 6 91074282 missense probably damaging 0.99
R1851:Nup210 UTSW 6 91016054 missense probably damaging 1.00
R2145:Nup210 UTSW 6 91028876 missense possibly damaging 0.81
R2196:Nup210 UTSW 6 91055244 missense probably benign 0.02
R2308:Nup210 UTSW 6 91040868 missense probably benign 0.19
R2419:Nup210 UTSW 6 91017556 splice site probably benign
R2912:Nup210 UTSW 6 91026974 missense probably damaging 1.00
R3413:Nup210 UTSW 6 91025242 missense probably benign 0.00
R3718:Nup210 UTSW 6 91020180 missense probably benign 0.04
R4058:Nup210 UTSW 6 91060620 missense probably benign 0.02
R4840:Nup210 UTSW 6 91031668 nonsense probably null
R4912:Nup210 UTSW 6 91017529 missense probably benign 0.01
R4967:Nup210 UTSW 6 91036469 missense possibly damaging 0.81
R4996:Nup210 UTSW 6 91053436 missense probably benign 0.16
R5074:Nup210 UTSW 6 91055327 missense probably benign 0.16
R5233:Nup210 UTSW 6 91026969 missense probably damaging 1.00
R5352:Nup210 UTSW 6 91069316 missense probably damaging 1.00
R5490:Nup210 UTSW 6 91085988 missense probably damaging 0.98
R5511:Nup210 UTSW 6 91026963 missense probably damaging 0.97
R5773:Nup210 UTSW 6 91085883 missense probably damaging 0.96
R6064:Nup210 UTSW 6 91055291 missense probably benign 0.01
R6209:Nup210 UTSW 6 91025355 missense probably benign
R6299:Nup210 UTSW 6 91074288 missense possibly damaging 0.68
R6705:Nup210 UTSW 6 91087960 missense possibly damaging 0.50
R6855:Nup210 UTSW 6 91040853 missense probably benign 0.13
R6856:Nup210 UTSW 6 91087913 nonsense probably null
R6911:Nup210 UTSW 6 91030130 missense probably damaging 0.98
R6955:Nup210 UTSW 6 91087927 missense probably damaging 1.00
R7045:Nup210 UTSW 6 91054451 missense probably damaging 1.00
R7081:Nup210 UTSW 6 91060665 missense possibly damaging 0.50
R7163:Nup210 UTSW 6 91073331 missense probably damaging 1.00
R7305:Nup210 UTSW 6 91087966 missense probably damaging 1.00
R7387:Nup210 UTSW 6 91021396 critical splice donor site probably null
R7404:Nup210 UTSW 6 91073245 missense probably benign 0.01
R7469:Nup210 UTSW 6 91018892 missense probably benign 0.08
R7603:Nup210 UTSW 6 91076697 missense probably benign 0.00
R7731:Nup210 UTSW 6 91071888 missense possibly damaging 0.50
R7822:Nup210 UTSW 6 91018777 missense possibly damaging 0.71
R8032:Nup210 UTSW 6 91074349 missense probably benign 0.02
R8039:Nup210 UTSW 6 91070233 missense probably benign 0.09
R8081:Nup210 UTSW 6 91076675 missense probably benign 0.00
X0067:Nup210 UTSW 6 91074280 missense probably damaging 1.00
Z1177:Nup210 UTSW 6 91020185 missense probably benign
Z1177:Nup210 UTSW 6 91087907 missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- GCCTCGTGTTTCTTAAGAGCTG -3'
(R):5'- CATGCACTCGTCGCTCAAC -3'

Sequencing Primer
(F):5'- CCTCGTGTTTCTTAAGAGCTGCAAAG -3'
(R):5'- CACAACTGACTTGTTTCCCTAGATAG -3'
Posted On2015-03-18