Incidental Mutation 'R3753:Iqsec3'
ID271309
Institutional Source Beutler Lab
Gene Symbol Iqsec3
Ensembl Gene ENSMUSG00000040797
Gene NameIQ motif and Sec7 domain 3
SynonymssynarfGEF, BRAG3
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3753 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location121372933-121473678 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 121376255 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 1135 (A1135T)
Ref Sequence ENSEMBL: ENSMUSP00000038653 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046373] [ENSMUST00000129815] [ENSMUST00000152103]
Predicted Effect probably benign
Transcript: ENSMUST00000046373
AA Change: A1135T

PolyPhen 2 Score 0.190 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000038653
Gene: ENSMUSG00000040797
AA Change: A1135T

DomainStartEndE-ValueType
coiled coil region 20 56 N/A INTRINSIC
low complexity region 57 95 N/A INTRINSIC
Blast:Sec7 285 354 5e-16 BLAST
low complexity region 367 386 N/A INTRINSIC
Blast:Sec7 476 507 2e-9 BLAST
low complexity region 508 531 N/A INTRINSIC
low complexity region 542 594 N/A INTRINSIC
low complexity region 598 628 N/A INTRINSIC
Sec7 652 843 9.53e-89 SMART
PH 874 985 4.03e0 SMART
low complexity region 1065 1105 N/A INTRINSIC
low complexity region 1126 1144 N/A INTRINSIC
low complexity region 1160 1178 N/A INTRINSIC
low complexity region 1182 1194 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000129815
SMART Domains Protein: ENSMUSP00000120847
Gene: ENSMUSG00000040797

DomainStartEndE-ValueType
coiled coil region 20 56 N/A INTRINSIC
low complexity region 57 95 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000152103
SMART Domains Protein: ENSMUSP00000116317
Gene: ENSMUSG00000040797

DomainStartEndE-ValueType
coiled coil region 20 56 N/A INTRINSIC
low complexity region 57 95 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency 98% (49/50)
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001J03Rik A T 5: 146,184,867 I74N probably damaging Het
Acp7 T A 7: 28,616,660 Y167F probably damaging Het
Acsl1 A T 8: 46,513,565 probably benign Het
Bcr T C 10: 75,135,940 V599A probably benign Het
Brd1 C T 15: 88,689,618 V1093I possibly damaging Het
Cep152 A G 2: 125,625,052 probably benign Het
Cstf2t T G 19: 31,083,295 L77R probably damaging Het
Drd3 C T 16: 43,817,103 R254W probably damaging Het
E2f1 C G 2: 154,564,022 G144R probably damaging Het
Fam103a1 C T 7: 81,767,647 R32C probably damaging Het
Fam187a C T 11: 102,885,849 P160S probably benign Het
Fam198a A T 9: 121,965,833 D351V probably damaging Het
Fat1 G A 8: 45,025,479 E2521K probably damaging Het
Fbln1 T A 15: 85,227,078 C144* probably null Het
Flii T C 11: 60,715,480 D1128G probably benign Het
Gata3 T A 2: 9,868,840 H281L probably benign Het
Gm20767 A T 13: 120,154,631 D2V possibly damaging Het
Irak4 T C 15: 94,561,595 I364T probably damaging Het
Mib2 A G 4: 155,655,284 F810S probably damaging Het
Nbn G A 4: 15,964,269 V115I probably damaging Het
Nfyc G T 4: 120,765,330 probably benign Het
Nup210 A T 6: 91,021,395 probably null Het
Olfr1057 C T 2: 86,374,915 V166I possibly damaging Het
Olfr123 T C 17: 37,796,232 S263P possibly damaging Het
Olfr330 C T 11: 58,529,690 A99T probably benign Het
Paqr8 A G 1: 20,935,632 T337A probably benign Het
Plce1 T C 19: 38,651,834 V508A probably benign Het
Prmt2 G T 10: 76,225,303 D116E probably benign Het
Prss51 T A 14: 64,096,175 probably benign Het
Prune2 T A 19: 17,125,454 V2659D probably benign Het
Ptpn3 C T 4: 57,270,144 R6H probably damaging Het
Rdh12 C T 12: 79,213,672 R181* probably null Het
Rsf1 T A 7: 97,662,152 D696E probably benign Het
Sh3rf2 C T 18: 42,111,308 R280C probably damaging Het
Slco6d1 T A 1: 98,499,777 I611K probably damaging Het
Snph G A 2: 151,593,454 P449L probably benign Het
Spg7 G C 8: 123,087,373 R457P probably damaging Het
Swap70 T A 7: 110,267,881 W297R probably damaging Het
Tcaf3 T A 6: 42,589,804 I784F probably damaging Het
Tox2 T A 2: 163,314,323 I138N probably damaging Het
Trim54 A C 5: 31,134,144 E203A probably damaging Het
Vmn2r19 A T 6: 123,315,589 T197S possibly damaging Het
Vmn2r28 T A 7: 5,488,027 H407L probably damaging Het
Wdr19 G A 5: 65,224,726 V430M probably damaging Het
Other mutations in Iqsec3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01349:Iqsec3 APN 6 121473124 missense possibly damaging 0.90
IGL01615:Iqsec3 APN 6 121410621 missense probably damaging 1.00
IGL01728:Iqsec3 APN 6 121412664 utr 3 prime probably benign
IGL01935:Iqsec3 APN 6 121383992 missense probably damaging 1.00
IGL02146:Iqsec3 APN 6 121383957 missense probably damaging 0.99
IGL02369:Iqsec3 APN 6 121412934 utr 3 prime probably benign
IGL02684:Iqsec3 APN 6 121412941 nonsense probably null
IGL03180:Iqsec3 APN 6 121413508 utr 3 prime probably benign
R0032:Iqsec3 UTSW 6 121473130 missense possibly damaging 0.71
R0088:Iqsec3 UTSW 6 121473289 missense probably damaging 0.97
R0189:Iqsec3 UTSW 6 121413562 utr 3 prime probably benign
R0193:Iqsec3 UTSW 6 121410724 missense probably damaging 1.00
R0528:Iqsec3 UTSW 6 121412784 utr 3 prime probably benign
R1885:Iqsec3 UTSW 6 121428367 intron probably benign
R2698:Iqsec3 UTSW 6 121413471 utr 3 prime probably benign
R3751:Iqsec3 UTSW 6 121376255 missense probably benign 0.19
R3947:Iqsec3 UTSW 6 121387824 nonsense probably null
R3948:Iqsec3 UTSW 6 121387824 nonsense probably null
R3949:Iqsec3 UTSW 6 121387824 nonsense probably null
R4006:Iqsec3 UTSW 6 121376228 missense probably damaging 1.00
R4007:Iqsec3 UTSW 6 121376228 missense probably damaging 1.00
R4210:Iqsec3 UTSW 6 121413040 utr 3 prime probably benign
R4535:Iqsec3 UTSW 6 121380018 missense possibly damaging 0.80
R4567:Iqsec3 UTSW 6 121387762 missense probably damaging 1.00
R5096:Iqsec3 UTSW 6 121386698 missense probably damaging 1.00
R5135:Iqsec3 UTSW 6 121383919 missense probably damaging 1.00
R5289:Iqsec3 UTSW 6 121386700 critical splice acceptor site probably null
R5537:Iqsec3 UTSW 6 121412644 utr 3 prime probably benign
R6555:Iqsec3 UTSW 6 121384219 missense probably damaging 1.00
R6942:Iqsec3 UTSW 6 121473103 missense probably damaging 1.00
R7122:Iqsec3 UTSW 6 121473358 missense unknown
R7372:Iqsec3 UTSW 6 121384032 nonsense probably null
R7394:Iqsec3 UTSW 6 121386610 missense possibly damaging 0.47
R7559:Iqsec3 UTSW 6 121387780 missense probably damaging 1.00
R7729:Iqsec3 UTSW 6 121383981 missense probably damaging 1.00
R7815:Iqsec3 UTSW 6 121473358 missense probably benign 0.17
Predicted Primers PCR Primer
(F):5'- AAGGGTAGAGCCTACACCAG -3'
(R):5'- TTCACAACAGGCTTCAAACGTC -3'

Sequencing Primer
(F):5'- GCAGAACTGATGAGGGTGGTTGT -3'
(R):5'- AGCACAGCCCCAAGTTGG -3'
Posted On2015-03-18