Incidental Mutation 'R3753:Fam103a1'
ID271313
Institutional Source Beutler Lab
Gene Symbol Fam103a1
Ensembl Gene ENSMUSG00000038646
Gene Namefamily with sequence similarity 103, member A1
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.074) question?
Stock #R3753 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location81762925-81769491 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 81767647 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 32 (R32C)
Ref Sequence ENSEMBL: ENSMUSP00000123342 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042166] [ENSMUST00000118190] [ENSMUST00000133034]
Predicted Effect probably benign
Transcript: ENSMUST00000042166
AA Change: R32C

PolyPhen 2 Score 0.081 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000039065
Gene: ENSMUSG00000038646
AA Change: R32C

DomainStartEndE-ValueType
Pfam:RAM 10 87 4.9e-28 PFAM
low complexity region 89 112 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000118190
AA Change: R32C

PolyPhen 2 Score 0.020 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000113339
Gene: ENSMUSG00000038646
AA Change: R32C

DomainStartEndE-ValueType
Pfam:RAM 9 89 5.1e-36 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000133034
AA Change: R32C

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Meta Mutation Damage Score 0.2095 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency 98% (49/50)
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001J03Rik A T 5: 146,184,867 I74N probably damaging Het
Acp7 T A 7: 28,616,660 Y167F probably damaging Het
Acsl1 A T 8: 46,513,565 probably benign Het
Bcr T C 10: 75,135,940 V599A probably benign Het
Brd1 C T 15: 88,689,618 V1093I possibly damaging Het
Cep152 A G 2: 125,625,052 probably benign Het
Cstf2t T G 19: 31,083,295 L77R probably damaging Het
Drd3 C T 16: 43,817,103 R254W probably damaging Het
E2f1 C G 2: 154,564,022 G144R probably damaging Het
Fam187a C T 11: 102,885,849 P160S probably benign Het
Fam198a A T 9: 121,965,833 D351V probably damaging Het
Fat1 G A 8: 45,025,479 E2521K probably damaging Het
Fbln1 T A 15: 85,227,078 C144* probably null Het
Flii T C 11: 60,715,480 D1128G probably benign Het
Gata3 T A 2: 9,868,840 H281L probably benign Het
Gm20767 A T 13: 120,154,631 D2V possibly damaging Het
Iqsec3 C T 6: 121,376,255 A1135T probably benign Het
Irak4 T C 15: 94,561,595 I364T probably damaging Het
Mib2 A G 4: 155,655,284 F810S probably damaging Het
Nbn G A 4: 15,964,269 V115I probably damaging Het
Nfyc G T 4: 120,765,330 probably benign Het
Nup210 A T 6: 91,021,395 probably null Het
Olfr1057 C T 2: 86,374,915 V166I possibly damaging Het
Olfr123 T C 17: 37,796,232 S263P possibly damaging Het
Olfr330 C T 11: 58,529,690 A99T probably benign Het
Paqr8 A G 1: 20,935,632 T337A probably benign Het
Plce1 T C 19: 38,651,834 V508A probably benign Het
Prmt2 G T 10: 76,225,303 D116E probably benign Het
Prss51 T A 14: 64,096,175 probably benign Het
Prune2 T A 19: 17,125,454 V2659D probably benign Het
Ptpn3 C T 4: 57,270,144 R6H probably damaging Het
Rdh12 C T 12: 79,213,672 R181* probably null Het
Rsf1 T A 7: 97,662,152 D696E probably benign Het
Sh3rf2 C T 18: 42,111,308 R280C probably damaging Het
Slco6d1 T A 1: 98,499,777 I611K probably damaging Het
Snph G A 2: 151,593,454 P449L probably benign Het
Spg7 G C 8: 123,087,373 R457P probably damaging Het
Swap70 T A 7: 110,267,881 W297R probably damaging Het
Tcaf3 T A 6: 42,589,804 I784F probably damaging Het
Tox2 T A 2: 163,314,323 I138N probably damaging Het
Trim54 A C 5: 31,134,144 E203A probably damaging Het
Vmn2r19 A T 6: 123,315,589 T197S possibly damaging Het
Vmn2r28 T A 7: 5,488,027 H407L probably damaging Het
Wdr19 G A 5: 65,224,726 V430M probably damaging Het
Other mutations in Fam103a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02732:Fam103a1 APN 7 81767725 critical splice donor site probably null
PIT4531001:Fam103a1 UTSW 7 81767579 missense possibly damaging 0.62
R3545:Fam103a1 UTSW 7 81768522 unclassified probably null
R4665:Fam103a1 UTSW 7 81768430 missense probably damaging 1.00
R4784:Fam103a1 UTSW 7 81768415 missense probably damaging 0.99
R6378:Fam103a1 UTSW 7 81767639 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACAGGGACTTTTGTTACTACTCC -3'
(R):5'- CACCTATTAAATGCGTACATCAGC -3'

Sequencing Primer
(F):5'- ACTACTCCATCTAAATTGTTCACTTC -3'
(R):5'- AGGCTGGCCTAGATCTCATAATC -3'
Posted On2015-03-18