Incidental Mutation 'R3753:Spg7'
ID 271318
Institutional Source Beutler Lab
Gene Symbol Spg7
Ensembl Gene ENSMUSG00000000738
Gene Name SPG7, paraplegin matrix AAA peptidase subunit
Synonyms Cmar, paraplegin
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.093) question?
Stock # R3753 (G1)
Quality Score 225
Status Validated
Chromosome 8
Chromosomal Location 123062942-123097760 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to C at 123087373 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Proline at position 457 (R457P)
Ref Sequence ENSEMBL: ENSMUSP00000115039 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000108868] [ENSMUST00000125975] [ENSMUST00000127664] [ENSMUST00000135991] [ENSMUST00000149248] [ENSMUST00000153285]
AlphaFold Q3ULF4
Predicted Effect probably damaging
Transcript: ENSMUST00000108868
AA Change: R457P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000104496
Gene: ENSMUSG00000000738
AA Change: R457P

DomainStartEndE-ValueType
low complexity region 5 60 N/A INTRINSIC
low complexity region 122 135 N/A INTRINSIC
Pfam:FtsH_ext 142 242 5.2e-12 PFAM
transmembrane domain 250 272 N/A INTRINSIC
AAA 341 481 1.96e-19 SMART
Pfam:Peptidase_M41 541 746 1.8e-74 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000125975
AA Change: R352P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000120361
Gene: ENSMUSG00000000738
AA Change: R352P

DomainStartEndE-ValueType
low complexity region 17 30 N/A INTRINSIC
Pfam:FtsH_ext 37 137 8.5e-12 PFAM
transmembrane domain 145 167 N/A INTRINSIC
AAA 236 376 1.96e-19 SMART
Pfam:Peptidase_M41 436 641 9.8e-74 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000127664
SMART Domains Protein: ENSMUSP00000118564
Gene: ENSMUSG00000092329

DomainStartEndE-ValueType
Pfam:Glycos_transf_2 104 287 7.4e-31 PFAM
Pfam:Glyco_transf_7C 261 331 4.9e-8 PFAM
RICIN 406 531 9.28e-27 SMART
Predicted Effect unknown
Transcript: ENSMUST00000128234
AA Change: R25P
SMART Domains Protein: ENSMUSP00000120793
Gene: ENSMUSG00000000738
AA Change: R25P

DomainStartEndE-ValueType
Pfam:AAA 1 48 5.8e-10 PFAM
Pfam:Peptidase_M41 110 222 9.7e-43 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128803
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130787
Predicted Effect probably benign
Transcript: ENSMUST00000135991
SMART Domains Protein: ENSMUSP00000118066
Gene: ENSMUSG00000000738

DomainStartEndE-ValueType
Pfam:Peptidase_M41 1 81 2.5e-30 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142150
Predicted Effect probably damaging
Transcript: ENSMUST00000149248
AA Change: R457P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000119552
Gene: ENSMUSG00000000738
AA Change: R457P

DomainStartEndE-ValueType
low complexity region 5 60 N/A INTRINSIC
low complexity region 122 135 N/A INTRINSIC
Pfam:FtsH_ext 142 242 3.9e-11 PFAM
transmembrane domain 250 272 N/A INTRINSIC
AAA 341 481 1.96e-19 SMART
Pfam:Peptidase_M41 541 746 7e-75 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152972
Predicted Effect probably damaging
Transcript: ENSMUST00000153285
AA Change: R457P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000115039
Gene: ENSMUSG00000000738
AA Change: R457P

DomainStartEndE-ValueType
low complexity region 5 60 N/A INTRINSIC
low complexity region 122 135 N/A INTRINSIC
Pfam:FtsH_ext 142 242 3.8e-11 PFAM
transmembrane domain 250 272 N/A INTRINSIC
AAA 341 481 1.96e-19 SMART
Pfam:Peptidase_M41 515 709 2.5e-68 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000153492
SMART Domains Protein: ENSMUSP00000133602
Gene: ENSMUSG00000000738

DomainStartEndE-ValueType
Pfam:FtsH_ext 1 102 1.3e-12 PFAM
transmembrane domain 110 132 N/A INTRINSIC
PDB:2QZ4|A 165 192 1e-8 PDB
Meta Mutation Damage Score 0.9204 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency 98% (49/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a mitochondrial metalloprotease protein that is a member of the AAA family. Members of this protein family share an ATPase domain and have roles in diverse cellular processes including membrane trafficking, intracellular motility, organelle biogenesis, protein folding, and proteolysis. Mutations in this gene cause autosomal recessive spastic paraplegia 7. Two transcript variants encoding distinct isoforms have been identified. [provided by RefSeq, Mar 2014]
PHENOTYPE: Homozygous null mice exhibit impaired motor skills, putativley associated with axonal degeneration in the central and peripheral nervous systems. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001J03Rik A T 5: 146,184,867 I74N probably damaging Het
Acp7 T A 7: 28,616,660 Y167F probably damaging Het
Acsl1 A T 8: 46,513,565 probably benign Het
Bcr T C 10: 75,135,940 V599A probably benign Het
Brd1 C T 15: 88,689,618 V1093I possibly damaging Het
Cep152 A G 2: 125,625,052 probably benign Het
Cstf2t T G 19: 31,083,295 L77R probably damaging Het
Drd3 C T 16: 43,817,103 R254W probably damaging Het
E2f1 C G 2: 154,564,022 G144R probably damaging Het
Fam103a1 C T 7: 81,767,647 R32C probably damaging Het
Fam187a C T 11: 102,885,849 P160S probably benign Het
Fam198a A T 9: 121,965,833 D351V probably damaging Het
Fat1 G A 8: 45,025,479 E2521K probably damaging Het
Fbln1 T A 15: 85,227,078 C144* probably null Het
Flii T C 11: 60,715,480 D1128G probably benign Het
Gata3 T A 2: 9,868,840 H281L probably benign Het
Gm20767 A T 13: 120,154,631 D2V possibly damaging Het
Iqsec3 C T 6: 121,376,255 A1135T probably benign Het
Irak4 T C 15: 94,561,595 I364T probably damaging Het
Mib2 A G 4: 155,655,284 F810S probably damaging Het
Nbn G A 4: 15,964,269 V115I probably damaging Het
Nfyc G T 4: 120,765,330 probably benign Het
Nup210 A T 6: 91,021,395 probably null Het
Olfr1057 C T 2: 86,374,915 V166I possibly damaging Het
Olfr123 T C 17: 37,796,232 S263P possibly damaging Het
Olfr330 C T 11: 58,529,690 A99T probably benign Het
Paqr8 A G 1: 20,935,632 T337A probably benign Het
Plce1 T C 19: 38,651,834 V508A probably benign Het
Prmt2 G T 10: 76,225,303 D116E probably benign Het
Prss51 T A 14: 64,096,175 probably benign Het
Prune2 T A 19: 17,125,454 V2659D probably benign Het
Ptpn3 C T 4: 57,270,144 R6H probably damaging Het
Rdh12 C T 12: 79,213,672 R181* probably null Het
Rsf1 T A 7: 97,662,152 D696E probably benign Het
Sh3rf2 C T 18: 42,111,308 R280C probably damaging Het
Slco6d1 T A 1: 98,499,777 I611K probably damaging Het
Snph G A 2: 151,593,454 P449L probably benign Het
Swap70 T A 7: 110,267,881 W297R probably damaging Het
Tcaf3 T A 6: 42,589,804 I784F probably damaging Het
Tox2 T A 2: 163,314,323 I138N probably damaging Het
Trim54 A C 5: 31,134,144 E203A probably damaging Het
Vmn2r19 A T 6: 123,315,589 T197S possibly damaging Het
Vmn2r28 T A 7: 5,488,027 H407L probably damaging Het
Wdr19 G A 5: 65,224,726 V430M probably damaging Het
Other mutations in Spg7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01862:Spg7 APN 8 123076930 missense probably damaging 1.00
IGL01868:Spg7 APN 8 123090236 critical splice donor site probably null
IGL02551:Spg7 APN 8 123076978 missense probably damaging 1.00
IGL02744:Spg7 APN 8 123093661 missense probably damaging 1.00
IGL03161:Spg7 APN 8 123087331 missense probably damaging 1.00
IGL03165:Spg7 APN 8 123080812 critical splice donor site probably null
R0729:Spg7 UTSW 8 123070417 missense probably damaging 0.96
R1580:Spg7 UTSW 8 123090238 unclassified probably benign
R1696:Spg7 UTSW 8 123090225 missense probably benign 0.05
R1909:Spg7 UTSW 8 123080741 missense probably benign 0.01
R3751:Spg7 UTSW 8 123087373 missense probably damaging 1.00
R3921:Spg7 UTSW 8 123087373 missense probably damaging 1.00
R3976:Spg7 UTSW 8 123079448 missense probably damaging 1.00
R4908:Spg7 UTSW 8 123080655 missense probably damaging 1.00
R4952:Spg7 UTSW 8 123090171 missense probably damaging 1.00
R5392:Spg7 UTSW 8 123087363 missense probably damaging 1.00
R5637:Spg7 UTSW 8 123094575 missense possibly damaging 0.82
R5684:Spg7 UTSW 8 123073884 missense probably damaging 0.99
R5810:Spg7 UTSW 8 123094569 missense possibly damaging 0.94
R6452:Spg7 UTSW 8 123079423 missense possibly damaging 0.54
R6453:Spg7 UTSW 8 123079423 missense possibly damaging 0.54
R6454:Spg7 UTSW 8 123079423 missense possibly damaging 0.54
R6750:Spg7 UTSW 8 123073911 missense probably damaging 1.00
R7090:Spg7 UTSW 8 123091752 critical splice donor site probably null
R7213:Spg7 UTSW 8 123090232 missense probably damaging 1.00
R7705:Spg7 UTSW 8 123073878 missense possibly damaging 0.63
R7811:Spg7 UTSW 8 123097425 missense possibly damaging 0.89
R7863:Spg7 UTSW 8 123089049 critical splice donor site probably null
R8375:Spg7 UTSW 8 123073829 missense probably damaging 0.99
R9228:Spg7 UTSW 8 123080669 missense possibly damaging 0.94
R9321:Spg7 UTSW 8 123076949 missense probably benign 0.22
R9508:Spg7 UTSW 8 123073884 missense probably damaging 0.99
Z1177:Spg7 UTSW 8 123090223 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CATTGGAAGCCGTTGTGAAGG -3'
(R):5'- AACAGCAGAGCTTCCTGTC -3'

Sequencing Primer
(F):5'- CTCATCGGTCTGTCCAGATGGAG -3'
(R):5'- AGCAGAGCTTCCTGTCCCAAG -3'
Posted On 2015-03-18