Incidental Mutation 'R3753:Bcr'
ID271321
Institutional Source Beutler Lab
Gene Symbol Bcr
Ensembl Gene ENSMUSG00000009681
Gene Namebreakpoint cluster region
Synonyms5133400C09Rik
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.935) question?
Stock #R3753 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location75060592-75184921 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 75135940 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 599 (V599A)
Ref Sequence ENSEMBL: ENSMUSP00000126377 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000164107]
Predicted Effect probably benign
Transcript: ENSMUST00000164107
AA Change: V599A

PolyPhen 2 Score 0.048 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000126377
Gene: ENSMUSG00000009681
AA Change: V599A

DomainStartEndE-ValueType
Pfam:Bcr-Abl_Oligo 3 75 1.2e-44 PFAM
low complexity region 86 109 N/A INTRINSIC
low complexity region 121 147 N/A INTRINSIC
low complexity region 342 358 N/A INTRINSIC
low complexity region 371 389 N/A INTRINSIC
low complexity region 461 470 N/A INTRINSIC
RhoGEF 501 689 6.22e-51 SMART
PH 708 867 7.95e-8 SMART
C2 911 1016 2.85e-11 SMART
RhoGAP 1064 1248 6.42e-70 SMART
Meta Mutation Damage Score 0.0740 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency 98% (49/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] A reciprocal translocation between chromosomes 22 and 9 produces the Philadelphia chromosome, which is often found in patients with chronic myelogenous leukemia. The chromosome 22 breakpoint for this translocation is located within the BCR gene. The translocation produces a fusion protein which is encoded by sequence from both BCR and ABL, the gene at the chromosome 9 breakpoint. Although the BCR-ABL fusion protein has been extensively studied, the function of the normal BCR gene product is not clear. The protein has serine/threonine kinase activity and is a GTPase-activating protein for p21rac. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutants are defective in hormonal and behavioral stress response regulation and prone to septic shock, whereas chimeric mice carrying a BCR-ABL fusion mutation mimicking human Philadelphia chromosome develop chronic myeloid leukemia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001J03Rik A T 5: 146,184,867 I74N probably damaging Het
Acp7 T A 7: 28,616,660 Y167F probably damaging Het
Acsl1 A T 8: 46,513,565 probably benign Het
Brd1 C T 15: 88,689,618 V1093I possibly damaging Het
Cep152 A G 2: 125,625,052 probably benign Het
Cstf2t T G 19: 31,083,295 L77R probably damaging Het
Drd3 C T 16: 43,817,103 R254W probably damaging Het
E2f1 C G 2: 154,564,022 G144R probably damaging Het
Fam103a1 C T 7: 81,767,647 R32C probably damaging Het
Fam187a C T 11: 102,885,849 P160S probably benign Het
Fam198a A T 9: 121,965,833 D351V probably damaging Het
Fat1 G A 8: 45,025,479 E2521K probably damaging Het
Fbln1 T A 15: 85,227,078 C144* probably null Het
Flii T C 11: 60,715,480 D1128G probably benign Het
Gata3 T A 2: 9,868,840 H281L probably benign Het
Gm20767 A T 13: 120,154,631 D2V possibly damaging Het
Iqsec3 C T 6: 121,376,255 A1135T probably benign Het
Irak4 T C 15: 94,561,595 I364T probably damaging Het
Mib2 A G 4: 155,655,284 F810S probably damaging Het
Nbn G A 4: 15,964,269 V115I probably damaging Het
Nfyc G T 4: 120,765,330 probably benign Het
Nup210 A T 6: 91,021,395 probably null Het
Olfr1057 C T 2: 86,374,915 V166I possibly damaging Het
Olfr123 T C 17: 37,796,232 S263P possibly damaging Het
Olfr330 C T 11: 58,529,690 A99T probably benign Het
Paqr8 A G 1: 20,935,632 T337A probably benign Het
Plce1 T C 19: 38,651,834 V508A probably benign Het
Prmt2 G T 10: 76,225,303 D116E probably benign Het
Prss51 T A 14: 64,096,175 probably benign Het
Prune2 T A 19: 17,125,454 V2659D probably benign Het
Ptpn3 C T 4: 57,270,144 R6H probably damaging Het
Rdh12 C T 12: 79,213,672 R181* probably null Het
Rsf1 T A 7: 97,662,152 D696E probably benign Het
Sh3rf2 C T 18: 42,111,308 R280C probably damaging Het
Slco6d1 T A 1: 98,499,777 I611K probably damaging Het
Snph G A 2: 151,593,454 P449L probably benign Het
Spg7 G C 8: 123,087,373 R457P probably damaging Het
Swap70 T A 7: 110,267,881 W297R probably damaging Het
Tcaf3 T A 6: 42,589,804 I784F probably damaging Het
Tox2 T A 2: 163,314,323 I138N probably damaging Het
Trim54 A C 5: 31,134,144 E203A probably damaging Het
Vmn2r19 A T 6: 123,315,589 T197S possibly damaging Het
Vmn2r28 T A 7: 5,488,027 H407L probably damaging Het
Wdr19 G A 5: 65,224,726 V430M probably damaging Het
Other mutations in Bcr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Bcr APN 10 75157071 unclassified probably benign
IGL00662:Bcr APN 10 75168100 splice site probably benign
IGL01359:Bcr APN 10 75159779 unclassified probably benign
IGL01737:Bcr APN 10 75154951 missense probably damaging 0.99
IGL01908:Bcr APN 10 75061873 missense possibly damaging 0.85
IGL01954:Bcr APN 10 75175341 splice site probably null
IGL02169:Bcr APN 10 75159882 missense probably benign 0.07
IGL02379:Bcr APN 10 75157148 missense probably benign 0.02
IGL02380:Bcr APN 10 75175299 missense probably benign
IGL02385:Bcr APN 10 75145403 missense probably damaging 1.00
IGL02657:Bcr APN 10 75154964 missense probably benign 0.00
IGL02682:Bcr APN 10 75166046 missense possibly damaging 0.67
IGL02959:Bcr APN 10 75160390 missense probably benign 0.44
accrual UTSW 10 75061506 missense possibly damaging 0.77
Appreciation UTSW 10 75061125 nonsense probably null
R0329:Bcr UTSW 10 75181634 missense possibly damaging 0.88
R0330:Bcr UTSW 10 75181634 missense possibly damaging 0.88
R0376:Bcr UTSW 10 75145327 missense probably damaging 1.00
R0685:Bcr UTSW 10 75131643 missense probably damaging 1.00
R0828:Bcr UTSW 10 75157207 unclassified probably benign
R0892:Bcr UTSW 10 75125063 missense probably benign 0.00
R1143:Bcr UTSW 10 75061365 missense probably benign 0.00
R1416:Bcr UTSW 10 75061506 missense possibly damaging 0.77
R1479:Bcr UTSW 10 75061125 nonsense probably null
R1611:Bcr UTSW 10 75125202 splice site probably null
R1636:Bcr UTSW 10 75131066 missense probably damaging 1.00
R1837:Bcr UTSW 10 75168100 splice site probably benign
R2341:Bcr UTSW 10 75131112 missense probably damaging 1.00
R2343:Bcr UTSW 10 75145422 missense probably benign 0.03
R4273:Bcr UTSW 10 75125111 missense probably damaging 0.97
R4624:Bcr UTSW 10 75153920 missense probably damaging 1.00
R4723:Bcr UTSW 10 75175329 missense probably benign 0.45
R5013:Bcr UTSW 10 75125066 missense probably benign 0.00
R5359:Bcr UTSW 10 75166085 missense probably damaging 0.99
R5458:Bcr UTSW 10 75154960 missense probably benign
R5982:Bcr UTSW 10 75176416 missense probably benign 0.08
R5988:Bcr UTSW 10 75175335 missense probably benign 0.01
R6220:Bcr UTSW 10 75062292 missense probably benign
R6827:Bcr UTSW 10 75131064 missense probably damaging 1.00
R6886:Bcr UTSW 10 75153937 missense probably damaging 1.00
R6990:Bcr UTSW 10 75131036 missense possibly damaging 0.80
R7003:Bcr UTSW 10 75061561 missense probably benign 0.08
R7424:Bcr UTSW 10 75157100 missense probably benign
R7443:Bcr UTSW 10 75143136 critical splice donor site probably null
R7488:Bcr UTSW 10 75160330 missense possibly damaging 0.80
Predicted Primers PCR Primer
(F):5'- TCGGAAGAGCAGGTTTCTG -3'
(R):5'- TCAGAGCTGGGGTTCATACC -3'

Sequencing Primer
(F):5'- AGGTTTCTGCAGCCCTCG -3'
(R):5'- ACTTTGTTCTCCCAACGACCG -3'
Posted On2015-03-18